Labshake search
Citations for Addgene :
51 - 100 of 2001 citations for 6 Chlorotetrazolo 1 5 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and p73C proteins were subcloned into pET15-b (Addgene, #24866), pET28-a ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 (titer ≥ 1×1013 vg/ml, working dilution 1:5) was a gift from Douglas Kim (Addgene viral prep #100833-AAV9 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... HSP104-b/Leu(WT) was a gift from Susan Lindquist (Addgene plasmid # 1156 ...
-
bioRxiv - Plant Biology 2023Quote: ... The B- and C-modules with mTurquoise2 (amplified from an AddGene-derived template (Goedhart et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509; http://n2t.net/addgene:37509; RRID:Addgene_37509), and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3-SARS2-B.1.617.2 (Delta) was a gift from David Nemazee (Addgene plasmid #172320 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...