Labshake search
Citations for Addgene :
151 - 200 of 1134 citations for 6 Chloro N methyl pyrimidine 4 5 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid pKAN-PCUP1-9myc-AID*(N) from Addgene (Morawska and Ulrich, 2013), and plasmid pGIK43 from Georgios Karras.
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Cell Biology 2020Quote: ... Each transfection consisted of 250 ng expression plasmid (pcDNA3-control (Addgene; n/a), pcDNA3-Sox2FLAG (homemad) ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340; http://n2t.net/addgene:56340; RRID:Addgene_56340) was a gift from Michael Davidson and was used as acquired ...
-
bioRxiv - Synthetic Biology 2021Quote: ... the mEmerald tag was PCR amplified from mEmerald-PLK1-N-16 vector (Addgene #54234 ...
-
bioRxiv - Biophysics 2021Quote: ... was a gift from Michael Davidson (mApple-MAPTau-N-10, Addgene plasmid # 54925). Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: Cells were transfected overnight in 10cm plates with N-GFP-RelA (Addgene #23255) or C-Flag-Rela (Addgene #20012 ...
-
bioRxiv - Cell Biology 2020Quote: mRuby2-MannII-N-10 was a gift from Michael Davidson (Addgene plasmid # 55903)(83) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... a chimeric coding sequence consisting of an N’-terminal HiBit (pEPYC0CM0258, Addgene T.B.C.) the uidA coding sequence ...
-
bioRxiv - Genetics 2020Quote: ... Dapi labelled the nuclei and m-Cherry-TNGP-N-10 (Addgene, Cat # 55145) localized the Golgi ...
-
bioRxiv - Cell Biology 2022Quote: ... The MAP4K4 sequence was cloned into a pLVpuro-CMV-N-EGFP (Addgene, #122848) lentiviral plasmid using the gateway system ...
-
bioRxiv - Microbiology 2023Quote: ... The codon-optimized HCoV-OC43 N sequence was amplified from plasmid # 151960 (Addgene) with primers HCoV-OC43-N c-opt(pLVX)_Fw (gaattcgccgccaccatgtccttcaccccggg ...
-
bioRxiv - Microbiology 2023Quote: ... The LMP1 coding region was amplified from MSCV-N LMP1131 (Addgene plasmid #37962) and cloned into pRetroX-IRES-ZsGreen via Gibson Assembly ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Biochemistry 2019Quote: ... and pFLAG-SREBP2Nt (N-terminal transcriptionally active domain, amino acids 1-482) (Addgene, 26807) were used to transfect cells (HEK293) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pDEST-CMV-N-mCherry was a gift from Robin Ketteler (Addgene plasmid # 123215) (Agrotis ...
-
bioRxiv - Neuroscience 2021Quote: ... and tTA from pAAV::TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene #92392) by the conventional PCR reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... Viruses were AAV5-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA (Addgene plasmid #92392), AAV5-M13-TEV-C-P2A-tdTomato (Addgene plasmid #92391) ...
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pLVU/GFP and pLEX_305-N-dTAG lentiviral plasmid vectors were from Addgene (#24177, #91797). pHTN HaloTag CMV-neo and pHTC HaloTag CMV-neo vectors were from Promega (G7721 ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 μg of psPAX2 packaging plasmid (plasmid #12260; Addgene, Teddington, UK), 2 μg pMD2.G envelope plasmid (plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Cell Biology 2020Quote: P4M-GFP and mApple-Talin-N-10 were obtained from Addgene (51469 and 54951 respectively). FAPP-GFP was a gift from Tamas Balla ...
-
bioRxiv - Cell Biology 2020Quote: ... mEmerald-N-Wasp-C-18 and mEmerald-Coronin1B from Michael Davidson (Addgene plasmids #54199, 54050), pmCherry-C1-WIP from Anna Huttenlocher ...
-
bioRxiv - Molecular Biology 2019Quote: ... as an N-terminal fusion into HSPA8 and HSPA1A pcDNA5 constructs (Addgene 19514 and 19510) to make pTP4458 and pTP4459 ...
-
bioRxiv - Cancer Biology 2019Quote: The mSMO and ShhN (Shh N-terminal domain) plasmids purchased from Addgene (#37673 and #37680). All vectors were propagated in XL10 Gold competent cells ...
-
bioRxiv - Immunology 2019Quote: ... and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler, #75134, Addgene, Watertown, MA, USA) as templates ...