Labshake search
Citations for Addgene :
51 - 100 of 1458 citations for 6 Chloro 2 Methoxy 3 Nitropyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Neuroscience 2021Quote: ... The two fragments (5’ homology arm and 3’ homology arm) were assembled into plasmid pBS-KS-attB1-2-PT-SA-SD-0-2xTY1-V5 (Addgene) that was linearized with XbaI and HindIII using In Fusion cloning ...
-
bioRxiv - Molecular Biology 2019Quote: cDNA from Source BioSicence clone C130076G01 was amplified with PCR adding restriction sites for NheI at 5’ end and AgeI at 3’ end (Supplementary Table 2) and cloned into pLIX_402 vector (a gift from David Root, Addgene #41394) using restriction ligation ...
-
bioRxiv - Biochemistry 2022Quote: Expression plasmid (pGEX-5X-3-SARS-CoV-2-3CL) was a gift from Alejandro Chavez & David Ho & Sho Iketani (Addgene plasmid # 168457 ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Microbiology 2021Quote: ... A gRNA sequence 5’-GGATGGGATCTTGGCGCACG-3’ targeting intronic sequence immediately prior to Exon 2 of Ace2 was cloned into the eSpCas9(1.1) plasmid (Addgene 71814). A targeting construct was designed to insert by homologous recombination the human ACE2 cDNA followed by a floxed WPRE-SV40 polyA and FRT-ed neomycin resistance cassette directly after the ATG-start codon of mouse Ace2 in exon 2 ...
-
bioRxiv - Genomics 2021Quote: ... iPSCs were transfected with pRT43 containing DHFR-dCas9-VPH and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT- C13-L1, gifts from Jizhong Zou (Addgene plasmid # 62196 ...
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Bioengineering 2023Quote: ... OCI-AML-2 and OCI-AML-3) were retrovirally transduced with MI-Luciferase-IRES-mCherry (gift from Xiaoping Sun, Addgene plasmid #75020 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sequence for L7-6 was obtained from pAAV/L7-6-GFP-WPRE (Addgene plasmid #126462) and ordered as a gBLOCK (IDT) ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319 ...
-
bioRxiv - Developmental Biology 2021Quote: ... psPAX2 (6 µg, Addgene plasmid # 12260) and pAdVAntage (3 µg ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6 μg of psPAX2 (12260; Addgene), and 3 μg of pVSVg (8454 ...
-
bioRxiv - Microbiology 2022Quote: ... 6 µg PMD2.G (Addgene, 12259), 18µg PsPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (6 μg, Addgene plasmid # 12260) and pAdVAntage (3 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 μg psPAX2 (Addgene, plasmid 12260) and 4 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg pMD2.G (Addgene, 12259), 4 μg pUMVC (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... a 20-mer sgRNA target sequence (5′-CTCAGAGGGGGCTCGACGCT-3′) at exon 2 of the TP53 gene was designed (28) and cloned into pX330 (Addgene #42230), which was a gift from Dr ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: Two gRNAs were designed to target the exon 3 of REV1 (Supplementary Table 2) and subcloned into the PX458 plasmid (Addgene, 48138). 5.0-8.0 × 105 BTAG cells were electroporated with 3 μg of each gRNA using Amaxa 4D nucleofector (Lonza ...
-
bioRxiv - Neuroscience 2023Quote: ... oligos encoding guide RNAs targeting intron 2 and intron 3 of murine Dyrk1a were cloned into plasmid pX459 v2.0 (Addgene plasmid # 62988) and sequence verified ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clones were generated using oligonucleotide primers listed in Supplementary Table 2-3 to amplify the gene fragment from cDNA and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536)60 ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Immunology 2024Quote: ... were carried out as following: MaSCs (passage 2-3) were transduced with sgP53 or sgNT cloned into lentiCRISPRv2-puro (Addgene, Plasmid #98290), passaged once ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μg pSAD-∆G-F3 (Addgene, 32634) with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...