Labshake search
Citations for Addgene :
201 - 250 of 1664 citations for 6 Chloro 1 benzofuran 7 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Neuroscience 2024Quote: ... 7 Chrna2-Crewt/wt) were injected bilaterally with 300 nl of AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene, LOT 44361-AAV9 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA sequences listed in Extended Data Table 7 were cloned into the lentiGuide-Crimson backbone (Addgene Plasmid # 70683). Non-replicating lentiviruses were generated by transient co-transfection of the transfer plasmids into HEK293T together with the packaging plasmids pMDL (Addgene Plasmid #12251) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Genetics 2020Quote: ... followed by incubation of annealed gRNA with 7 pmol of purified Cas9 (made after expression of Addgene #69090) [49] ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160; http://n2t.net/addgene:54160; RRID:Addgene_54160)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ; http://n2t.net/addgene:56596 ; RRID:Addgene_56596), EGFP-DCX was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Neuroscience 2023Quote: ... The CMV::tdTomato-Lifeact-7 plasmid (abbreviated Lifeact throughout the manuscript) was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2020Quote: ... YFP-Parkin was a gift from Richard Youle (Addgene plasmid #23955)6 and EGFP-LC3 was a gift from Karla Kirkegaard (Addgene plasmid #11546)7 ...
-
bioRxiv - Neuroscience 2023Quote: ... was injected AAV1.Syn-GCaMP6m (pAAV.Syn.GCaMP6m.WPRE.SV40 from Addgene, #100841, titer 6-8 ✕ 1012). To express tdTomato in GABAergic neurons ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ...
-
bioRxiv - Neuroscience 2023Quote: Adult mice were stereotaxically injected at 7-10 weeks of age with 600 nl of 1.5×1013 vg/ml AAV1-CKIIa-stGtACR2-FusionRed (AddGene) or 7×1012 vg/ml AAV1-CKIIa-mCherry control at bilateral ACC (antero-posterior (AP ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... experimental animals received bilateral infusions (0.5 µL/hemisphere) of AAV5-hSyn-DIO-hM3D(Gq)-mCherry (7×1012 vg/mL; Addgene) into the VTA as described in [32] ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636; http://n2t.net/addgene:36046; RRID:Addgene_36046) and pT7-7 α-Syn A53T (Addgene plasmid #10572737 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 µL of 4.6 x 1012vg/mL AAV5-hSyn-DIO-hM4D(Gi)-mCherry (UNC Viral Vector Core; (Krashes et al., 2011)) or 7 x 1012vg/mL AAV5-hSyn-DIO-mCherry (Addgene) was injected at 2.1 mm below the surface of the brain (Andrews-Zwilling et al. ...
-
bioRxiv - Biophysics 2021Quote: The wild type SARS-CoV-2 S HexaPro expression plasmid was a gift from Jason McLellan (7) and obtained from Addgene (plasmid #154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... CRF1-cre mice were injected with 500 nL/hemisphere of AAV5-hSyn-DIO-eGFP (50457-AAV5; titer ≥ 7×10¹² vg/mL, Addgene) into the VTA (ML ±0.60 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #37825-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #29777-AAV5 ...
-
bioRxiv - Neuroscience 2022Quote: ... unilateral injections of 50-70 nL AAV5-CAG-ArchT-GFP (titer ≥ 7× 1012 vg/mL; gift from Edward Boyden and purchased through UNC Vector Core; now commercially available from Addgene viral preparation #29777-AAV5 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2024Quote: ... A 603 bp long nucleotide encoding for cystatin-7 was cloned into the BamHI/EcoRI sites of pAAV-hSyn-EGFP (# 50465, Addgene) to receive the plasmid pAAV-hSyn-Cst7 ...
-
bioRxiv - Neuroscience 2024Quote: ... animals were injected bilaterally in the mPFC with an anterograde Cre-dependent AAV5-hSyn-DOI-hM3Dq-mCherry (7×10¹² vg/mL, plasmid #44361, Addgene) for RHA rats (hM3Dq-group ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...