Labshake search
Citations for Addgene :
351 - 400 of 2912 citations for 6 CHLORO 2 3 4 9 TETRAHYDRO 1H CARBAZOL 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Microbiology 2020Quote: ... were plated in a 100-mm tissue culture dish and transfected the next day when they were about 75% confluent with a combination of the following plasmids: 9 µg of pLV-eGFP (a gift from Pantelis Tsoulfas (Addgene plasmid # 36083 ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV2/9-CAG-FLEX-RVG) were commercially obtained from the Boston Children’s Hospital Viral Core (Addgene # 48332 and 48333, respectively). Virus aliquots were stored at −80 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mammalian expression vector for St1Cas9 (LMD-9) fused to SV40 NLS sequences at the N- and C-terminus (MSP1594_2x_NLS; Addgene plasmid #110625) was constructed from MSP1594 (Kleinstiver et al. ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-EF1a-SaCas9-P2A-HA produced from the plasmid pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA (Addgene #113688) (46) ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...
-
bioRxiv - Plant Biology 2023Quote: ... in one-step restriction-ligation reactions with a CaMV35sP-ΩTMV (pICH51277; Addgene #50268) and CaMV35sT (pICH41414) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM4D(Gi)-mCherry (Addgene, n=8, 4 male, 4 female) or AAV8-hSyn-DIO-GFP (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Cell Biology 2022Quote: ... and pLKO.6 sfCherry were generated from pLKO.1 puro plasmid (Addgene plasmid # 8453; http://n2t.net/addgene:8453; RRID:Addgene_8453; a gift from Bob Weinberg) (Stewart et al. ...
-
Targeting Noradrenergic Neurons of the Locus Coeruleus: A Comparison of Model Systems and StrategiesbioRxiv - Neuroscience 2022Quote: ... Injections of rAAV2/9-Ef1a-DO-DIO-tdTomato-eGFP (2.3 × 1013 gc/ml; kindly gifted from Bernardo Sabatini; AddGene plasmid #37120)34 were performed in TH- and DBH-cre animals to estimate the viral spread ...
-
bioRxiv - Biophysics 2022Quote: ... The following expression vectors were used for plasmid DNA transfections: pCMV-mEmerald-FilaminA-N-9 (Addgene #54098, gift from Michael Davidson), pCMV-mCherry-FilaminA-N-9 (Addgene #55047 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... L2 assembly: L1 modules and annealed oligonucleotides (8-9, Table S5) assembled into the L2 destination vector pAGM4723-Del (Addgene #112207). The final plasmids ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: ... two gRNAs from a different human gRNA library (AVANA library)118 for each of the 9 genes were cloned into the pLentiCRISPR V2 vector that also expresses Cas9 (Addgene, #52961). Two non-targeting gRNAs were also cloned into the same vector to serve as controls ...
-
bioRxiv - Genetics 2019Quote: ... Cells were then seeded in a 12 well plate prior transfection (protocol stated above) of the spCas-9 expression vector (Addgene #44758), gRNA and homologous region and a non-homologous recombination inhibitor (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2023Quote: ... or VIP-Cre80 mouse lines in combination with the Cre-inducible viral expression of GCaMP6f in the ACC (AAV1/9-SYN-FLEX-GCaMP6f; Addgene, #100833).
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Cell Biology 2021Quote: ... or into ‘All-in-one-GFP’ plasmid (AIO-GFP, gift from Steve Jackson (Addgene plasmid # 74119 http://n2t.net/addgene:74119 ...
-
bioRxiv - Neuroscience 2021Quote: ... and subsequently combined into one vector by SacII digestion and ligation (Addgene, plasmid #122563). The Cre sequence was amplified using pCR8GW-Cre-pA-FRT-kan-FRT as template DNA (Suster et al. ...