Labshake search
Citations for Addgene :
701 - 750 of 1060 citations for 6 Bromo 2 4 ethoxyphenyl quinoline 4 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Molecular Biology 2024Quote: Neurogenin 2 (NGN2) was expressed in iPSC lines using a tetracycline inducible promoter (Addgene 172115) integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S-mEmerald construct was made by cloning the mEmerald sequence (Addgene, Plasmid #53976) to the C-terminal end of the SARS CoV-2 S-protein in the pCG expression vector ...
-
bioRxiv - Neuroscience 2020Quote: kn-p65AD was generated by co-injecting pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915) and ΦC31 into the embryos of MI15480 (BL61064) ...
-
bioRxiv - Cancer Biology 2021Quote: Guide RNAs for TP53 and SETD2 were constructed and cloned into lenti CRISPR v-2 (Addgene, 52961) according to the original online protocol of the Zhang lab (http://www.genome-engineering.org/crispr/wp-content/uploads/2014/05/CRISPR-Reagent-Description-Rev20140509.pdf) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 0.5 μg of SARS-CoV-2 Spike plasmid (a gift from Fang Li, Addgene plasmid #145032) using Lipofectamine 3000 transfection reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses were generated by co-transfection of viral vectors (2 μg) with pCMV-VSVG (0.25 μg) (Addgene) into Phoenix-gp cells with 90% confluency in a 6-well plate ...
-
bioRxiv - Microbiology 2022Quote: ... and are also available on Addgene (pLVX-EF1alpha-SARS-CoV-2-nsp14-2xStrep-IRES-Puro, Addgene #141380). Nsp10-Flag plasmid was a gift from the Ott lab.
-
bioRxiv - Biophysics 2022Quote: ... These cells (1.5 × 106) were transfected with 2 μg of plasmid encoding eGFP-Cre recombinase (Addgene # 11923), a gift from Brian Sauer (Le et al. ...
-
bioRxiv - Immunology 2022Quote: ... the SARS-CoV-2 S HexaPro plasmid was a generous gift from Jason McLellan (Addgene plasmid # 154754) (19) ...
-
bioRxiv - Neuroscience 2020Quote: ... for imaging hippocampal pyramidal cells or pAAV-mDlx-GCaMP6f-Fishell-2 (a gift from Gordon Fishell, Addgene plasmid # 83899 ...