Labshake search
Citations for Addgene :
301 - 350 of 2159 citations for 6 Amino 6 deoxy 1 2 o isopropylidene a D glucofuranose hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: An HBV genotype D subtype ayw replicon (62) was obtained from Addgene. HBV Ae (genotype A) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.7 µg pMD2.G (a gift from D. Trono, Addgene #12259), mixed with 9 µL lipofectamine 2000 transfection reagent in 2 mL Opti-MEM-I medium ...
-
bioRxiv - Microbiology 2023Quote: ... respectively and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575 ...
-
bioRxiv - Genetics 2021Quote: ... the cassette containing the C terminus half of the DddAtox (split at 1397 amino acid position) and UGI was amplified from the DdCBE plasmid (Addgene plasmid no. 157844). The PCR amplicon was digested with XbaI and BsU36I restriction enzyme and cloned in the pkTol2c-FusXTBE-N vector linearized with XbaI and Bsu36I to generate pkTol2c-FusXTBE-C plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... the inhibitory channelrhodopsin stGtACR2 (soma-targeted Guillardia theta anion-conducting channelrhodopsin 2, pAAV_hSyn1-SIO-stGtACR2-FusionRed, titer > 1 x 1013 particles/mL, Addgene). The vectors were injected (0.5 µl each side ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Cancer Biology 2021Quote: ... plus pSPAX2 and pMD2.G (gifts from D. Trono; Addgene #12260 and #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pseudo typed with pMD2.G (gift of D. Trono; Addgene plasmid #12259). Following transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... sechellia UAS-SPARC2-D-CsChrimson: we digested a SPARC2-backbone vector (Addgene #133562) with SalI and inserted a CsChrimson-Venus cassette after PCR amplification from pBac(UAS-ChR2 CsChrimson,3xP3::dsRed ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Cell Biology 2022Quote: ... OMP25 was PCR amplified from paGFP-Omp25 (gift from D. Sabatini, Addgene plasmid #69598) and cloned with XhoI/BamHI into mMaple-C1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... were co-transfected with plasmids pMD2.G (provided by D. Trono; Addgene no. 12259) and pCMV-deltaR8.91 (Lifescience market) ...