Labshake search
Citations for Addgene :
301 - 350 of 2286 citations for 6 1 Aminoethyl 2H 1 4 benzoxazin 3 4H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1 μg of psPAX2 (Addgene #12260), and with 21 μL of TransIT-Lenti (Mirus #6603) ...
-
bioRxiv - Genomics 2020Quote: ... and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/1.hSyn.ChR2(H134R)-eYFP.WPRE.hGH (Addgene 26973P) was injected in the pulvinar in the left hemisphere ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μg pMD2.G (envelope plasmid; Addgene), and 3 μg psPAX2 (packaging plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... pLKO.1 puro GFP siRNA (Addgene, # 12273)43 ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μg gag/pol (psPAX2, Addgene, 12260), and 0.25 μg VSV-G (pMD2.G ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-1304) (Addgene # 74244); pCMV6-XL4 ASXL1 (p.Y591X ...
-
bioRxiv - Microbiology 2021Quote: ... pet41s GST ATF6αTAD (aa 1-150) (Addgene) contained the TAD domain.
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1 × 1013 copies/mL) (Addgene, Watertown, MA) were injected into the PeF (250 nL/side ...
-
bioRxiv - Cell Biology 2022Quote: ... kif5b(1-560)-EGFP-6His (AddGene #15219), and Sfp-6His (AddGene #75015 ...
-
bioRxiv - Neuroscience 2023Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and KIF5C(1-560)-mCit (Addgene #61676) were a gift from Kristen Verhey92 ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1-shGFP control (Addgene, cat#30323); pLKO.1-shATR (TCRN0000039615 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G (1 µg, Addgene, 12259), plus the pscALPS-hACE2 or -cACE2 (1 µg ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Immunology 2024Quote: ... psPAX2 (1 µg; Addgene plasmid no. 12260) and pTRIP-SFFV-CD271-P2A-ACE2 (1.6 µg ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then were inserted into pBP-Gal80Uw-6 (#26236, Addgene) via an L-R reaction with GATEWAY LR clonase II plus enzyme mix (12538120 ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450 ...
-
bioRxiv - Neuroscience 2019Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl−1) and either p3xP3-EGFP.vas-int.NLS (400 ng µl−1) (Addgene #60948)69 or pBS130 (encoding phiC31 integrase under control of a heat shock promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...