Labshake search
Citations for Addgene :
51 - 100 of 679 citations for 5 Pyrimidinecarbonitrile 4 hydrazino 8CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Bioengineering 2022Quote: ... respectively (Supplementary Data 4, Addgene #183903 and #183904). For piggyBac integration near the Ae ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µg of pCMV delta R8.2 (Addgene #12263) and 5 µg of vector (pCDH-CMV-MCS-EF1-GFP empty ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µg of psPAX2 (Addgene, cat# 12260) using Lipofectamine 2000 Transfection Reagent according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 µg of pVSV-G (Addgene, Plasmid #8454), and 10 µg of lentiviral plasmid of interest were used ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...
-
bioRxiv - Biophysics 2021Quote: ... Fractions containing the target proteins were dialyzed against PBS (pH 7.4) and the His6-SUMO-tag was removed by enzymatic cleavage using human SENP1 protease at 4°C overnight (Addgene #16356) (51) ...
-
bioRxiv - Neuroscience 2020Quote: ... and the helper pAAV2/5 (Addgene #104964), pAAV2/8 (Addgene #112864) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg pCL-Eco (#12371, Addgene) in Opti-MEM with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 5 µg of psPax2 (Addgene, Cat# 12260), and 2 µg of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg envelope plasmid pMD2.G (Addgene), and 20 µg transfer plasmid (pTRIPZ ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (for AAV5; Addgene plasmid # 104964), or pAAV2/9n (for AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Systems Biology 2019Quote: ... A20-targeting guide RNAs (5’ – CACCGTTTGCTACGACACTCGGAAC – 3’, and 5’ – CACCGCTCGGAACTTTAAATTCCGC – 3’) were cloned into lentiCRISPR v2 (Addgene Plasmid #52961)48 and used for lentivirus production in HEK293T cells ...
-
bioRxiv - Neuroscience 2019Quote: ... 5 µl of pre-diluted AAV8-p4BDNF-ERT2CreERT2 was mixed with 5 µl of AAV8-CAG-FLEX-tdTomato (Addgene) and 5 µl of AAV1-hSyn-eGFP-WPRE-bGH (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Genetics 2021Quote: ... PiggyBac cargo plasmids used in Figure 3 and shown in Extended Data Figure 3 and pegRNA-expressing plasmids used in Figure 4 and Extended Data Figure 4 were created using the Mammalian Toolkit (Addgene article #2819751028), which was a gift from Hana El-Samad (UCSF).
-
bioRxiv - Neuroscience 2020Quote: ... These vectors are pCXLE- hOCT3/4-shp53-F (Addgene, Watertwon ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of pCMVR8.74 packaging vector (Addgene plasmid #22036) and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2019Quote: ... or pX330S-4 (Addgene #58780, deposited by Feng Zhang) according to the protocol available from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene). Mice were also injected unilaterally in the mPFC (1.7 anterior-posterior (AP) ...
-
bioRxiv - Microbiology 2023Quote: ... described in(4) and obtained from Addgene (plasmid # 115809) to produce the HIV-1 LTR-eGFP virus ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Synthetic Biology 2023Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).