Labshake search
Citations for Addgene :
301 - 350 of 1492 citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methoxy 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (2 µg; Addgene, Cat# 12260) were co-transfected with lentiviral expression construct (3 µg ...
-
bioRxiv - Genomics 2023Quote: ... and pMDG.2 (envelope vector; Addgene #12259) with the TKOv3 lentiCRISPR plasmid library [59] ...
-
bioRxiv - Neuroscience 2023Quote: ... ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246), and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Neuroscience 2020Quote: ... This product was subcloned into pBPLexa:P65UW (Addgene plasmid # 26231, 63 or pBPGal80uw-6 (Addgene plasmid # 26236, 63), which were gifts from Gerry Rubin ...
-
bioRxiv - Neuroscience 2020Quote: ... In one C57BL/6 animal each we used AAV5-Syn-GCaMP6s or AAVrg-Syn-jGCaMP7f (Addgene, USA) with similar results to those obtained with GCaMP6f (Supplementary Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... RB1 and TP53 sgRNA sequences highlighted in Supplementary Table 6 were cloned in a LentiCRISPRv2 (Addgene # 52961) backbone (47) ...
-
bioRxiv - Microbiology 2024Quote: ... Guide RNAs targeting exon 6 of Akr1c13 were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230). A T7-sgRNA PCR product was amplified and in vitro transcribed as previously described (65 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Molecular Biology 2024Quote: ... The insert containing CGG repeats within the 5’UTR of FMR1 gene fused with EGFP sequence was derived from 5’UTR CGG 99x FMR1-EGFP (Addgene plasmid #63091). The insert was ligated into the vector instead of EGFP sequence ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti PGK GFP Puro (w509-5) (Addgene 19070) were gifts from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... using vector sequence derived from LV1-5 (Addgene #68411) and cDNAs of SURF4 and Katushka2S (a gift from Gary Luker(100)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...