Labshake search
Citations for Addgene :
251 - 300 of 1129 citations for 5 Isoxazolol 4 methyl 3 trifluoromethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg pUMVC (Addgene, 8449) and 18 μg transfer plasmid were mixed in 700 μL DMEM medium (Corning ...
-
bioRxiv - Biochemistry 2022Quote: ... The wild-type 14-3-3 ζ gene was cloned into NcoI/XhoI digested pBAD plasmid (Addgene #85482) with a TEV cleavable C-terminal His6 purification tag ...
-
bioRxiv - Neuroscience 2023Quote: ... neonatal Swiss Webster or C57Bl/6 (P0–3) mice were anesthetized on ice for 3 min before injecting viral vectors (AAV5.GfaABC1D.GCaMP6f.SV40 [Addgene, 52925-AAV5] ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg psPAX2 (packaging plasmid; Addgene) was performed using iN-fect (Intron Biotechnology ...
-
bioRxiv - Cell Biology 2021Quote: ... and pGH8 (Prab-3::mCherry, Addgene #19359) (Frøkjaer-Jensen et al. ...
-
bioRxiv - Genomics 2022Quote: ... and 3 μg pMD2.G (Addgene, #12259) into 293T cells cultured in 100 mm dish ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of PHGDH plasmid or 4 μg of empty vector plasmid (Addgene, plasmid #52107) was mixed with 4 μg of DNA RV helper plasmid (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Microbiology 2023Quote: ... Truncation mutations in NL4-3 were created by subcloning the region of NL4-3 between EcoRI to XhoI into pBlueScript KS(-) (Addgene), followed by site-directed mutagenesis to introduce a stop codon to generate the desired truncation mutation ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...