Labshake search
Citations for Addgene :
1 - 50 of 587 citations for 5 β DIHYDRO 17 HYDROXYPROGESTERONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Cell Biology 2023Quote: For β-catenin isoform experiments: β-catenin34–87GFP construct was generated from the original plasmid MSCV-β-catenin-IRES-GFP (Addgene Plasmid #14717). These constructs were transfected into MEFs by Lipofectamine LTX&PlusTM (Invitrogene A12621) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Cancer Biology 2022Quote: ... β-catenin shRNA was purchased from Addgene (pLKO.1 puro shRNA β-catenin #18803). Scramble siRNA and p68 siRNA were purchased from Santa Cruz Biotechnology (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Xenopus β-catenin-GFP (Addgene #16839), Xenopus cNLS-β-catenin-GFP (Addgene #16838) ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Cell Biology 2022Quote: ... pAc-GFPC1-Sec61 β (Addgene #15108) was inserted into pFRB-mCherry-C1 using BglII and EcoRI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... β-Lactamase gene (amplified from Addgene plasmid RRID ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG- β-catenin K19R/K49R(Addgene plasmid #44751 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Xenopus cNLS-β-catenin-GFP (Addgene #16838), GST-human β-catenin (Addgene #24193) ...
-
bioRxiv - Cell Biology 2019Quote: ... and mCherry-Sec61 β (Addgene plasmid # 49155) were obtained from Drs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... encoding β-glucuronidase (GUS; pICSL80016, Addgene #50332) and a C’-terminal yellow fluorescent protein (YFP ...
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Biochemistry 2021Quote: ... The plasmids pmCherry-β-actin (Addgene #54967, RRID:Addgene_54967) and pmCardinal-paxillin (Addgene #56171 ...
-
bioRxiv - Biochemistry 2021Quote: ... The plasmids pmCherry-β-actin (Addgene #54967, RRID:Addgene_54967) and pmCardinal-paxillin (Addgene #56171 ...
-
bioRxiv - Cell Biology 2019Quote: ... GFP-β-catenin was from Addgene (Cambridge, MA) and GFP empty vector was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2019Quote: ... pEGFP-N1:Importin-β was obtained by Addgene, made by Patrizia Lavia (plasmid # 106941) ...
-
bioRxiv - Plant Biology 2022Quote: ... or the β-glucuronidase (GUS) control (Addgene #50332), were assembled with pICH85281 [mannopine synthase promoter+W (MasWpro) ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Cancer Biology 2022Quote: Sleeping beauty based β-catenin N90 (ΔN90) (Addgene; 31785), YAP (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: The coding sequences of β-tubulin-HaloTag (Addgene #64691) and mCherry-p50 were cloned into a puromycin-resistant lentiviral vector (Addgene #114021 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828 ...
-
bioRxiv - Biochemistry 2023Quote: The β-lactamase plasmid (pExp-Bla, Addgene plasmid #112561) was expressed in E ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
bioRxiv - Bioengineering 2024Quote: ... DoubleCatcher β-Lock (GenBank and Addgene deposition in progress), DoubleCatcher γ-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Genetics 2022Quote: ... Guides were cloned into SpCas9-2A-GFP (pX458)17 plasmid (Addgene #48138, a gift of Feng Zhang). CRISPR guides used in this study are presented in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2019Quote: ... and β-arrestin 1-FLAG (#14687) were obtained from Addgene.
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-EPLIN-β-were purchased from Addgene (50529, 40948, 40947). For Flag-Rab40b-4A mutants were generated from an existing PLVX-FLAG-Rab40b plasmid [17] ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Cell Biology 2020Quote: We PCR amplified Ecad using pEGFP-N1-Ecad plasmid [46] and V5-TurboID using mutant BirA R118S (TurboID) (Addgene [17]) using PCR primers (Table S4) ...
-
bioRxiv - Cancer Biology 2022Quote: ... we transfected HEK 293T/17 cells with different plasmids together with the packaging plasmids pMD2.G (Gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T/17 cells were cotransfected with the respective transfer vector and second-generation lentiviral cassettes (packaging vector psPAX2 (Addgene RRID:Addgene_12260) and envelope vector pMD2.G (Addgene RRID:Addgene_12259) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the coding sequence of mNeonGreen was PCR-amplified from pAc5-V5::mNeonGreen [17] and ligated into the EcoRI-digested pQUAST (#24349, Addgene) vector using In-Fusion ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used a TGF-β reporter plasmid pSBE4-Luc (Addgene, plasmid #16495). This plasmid contains four tandem copies of the Smad binding sites ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828; http://n2t.net/addgene:16828; RRID:Addgene_16828), FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750; http://n2t.net/addgene:44750; RRID:Addgene_44750), FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Genetics 2021Quote: ... Stable integration of a WT SCN5A into LP-cells was achieved using an optimized SB transposon system (17) using the pSBbi-GN plasmid (a gift from Eric Kowarz, Addgene #60517), which contains SB transposon sequences for genomic integration flanking a promoter upstream of GFP and a second promoter upstream of a multiple cloning site (MCS ...