Labshake search
Citations for Addgene :
401 - 450 of 1681 citations for 4 nitro 5 ethyl 2 methylpyridine n oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... SK-N-DZ cells expressing dCas9-VP64 were transduced with lentiviral particles encoding the p65-HSF1 transactivator complex (pLentiMPH2, Addgene plasmid #89308 was a gift from Feng Zhang) ...
-
bioRxiv - Cell Biology 2022Quote: ... Dharmacon MHS6278-202829730) to an expression vector with N-terminal GST and 6XHis: pET28GST-LIC was a gift from Cheryl Arrowsmith (Addgene plasmid # 26101 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mammalian expression vector for St1Cas9 (LMD-9) fused to SV40 NLS sequences at the N- and C-terminus (MSP1594_2x_NLS; Addgene plasmid #110625) was constructed from MSP1594 (Kleinstiver et al. ...
-
bioRxiv - Molecular Biology 2019Quote: Human p531-393 in pGEX-2TK (Ampicillin) coding for an in-frame N-terminal GST tag was a gift from Cheryl Arrowsmith (Addgene plasmid # 24860 ...
-
bioRxiv - Molecular Biology 2019Quote: ... coding for an in-frame N-terminal GST tag was a gift from Cheryl Arrowsmith (Addgene plasmid # 24860; http://n2t.net/addgene:24860; RRID:Addgene_24860 and (33)) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... His-tagged (N-terminus) sfGFP cloned into a pBAD vector (pBAD-sfGFP)32 was a gift from Michael Davidson & Geoffrey Waldo (Addgene plasmid #54519 ...
-
bioRxiv - Genetics 2020Quote: ... of homology arms (∼400bp) PCR amplified from genomic DNA and the FKBP12F36V sequence amplified from plasmid pLEX_305-N-dTAG (Addgene # 91797) (Nabet et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... and the plasmid pcDNA HA Arf1 DN T31 N (plasmid 10833) provided by Thomas Roberts (Furman, et al; 2002) were obtained from Addgene. Plasmids pECFP-C1-Rab1a WT ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biochemistry 2022Quote: ... All expression constructs were in the form containing an N-terminal His6 and maltose-binding protein (MBP) tag (Addgene #11517).
-
bioRxiv - Developmental Biology 2022Quote: ... or synthesized (NLS and N1ICD the fragment of [ENSMUST00000028288.5] encoding the C-terminal 789 AA of the Notch1 protein) and cloned with sequence encoding an N- or C-terminal eGFP into a modified version of pLKO.3G (Addgene, Cat #14748 ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Molecular Biology 2022Quote: ... the coding sequence was moved into a modified pDEST destination vector with an N-terminal FLAG tag and into modified pDARMO (pDarmo.CMVT_v1 was a gift from David Sabatini [Addgene plasmid #133072]) expression plasmids with N-terminal 3xFLAG- and Strep-tags ...
-
bioRxiv - Molecular Biology 2022Quote: ... Entry clones were recombined with MSCV-N-Flag-HA-IRES-PURO(54) (a gift from Wade Harper, Addgene plasmid # 41033) using Gateway LR Clonase II (Life Technologies) ...
-
bioRxiv - Biochemistry 2023Quote: Dephosphorylated AurA (residues 122-403, TEV-cleavable, N-terminal His6-tagged, kanamycin-resistance) in pET28a and LPP (#79748) from Addgene were cotransformed in BL21(DE3 ...
-
bioRxiv - Biophysics 2023Quote: A plasmid containing the catalytic domain [258–539] of STEP (PTPN5) with an N-terminal 6xHis & TEV cleavage site was obtained via Addgene from Nicola Burgess-Brown (Addgene plasmid #39166 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 12μg of each pHAGE lentiviral construct encoding the various HCoV N-EGFP were co-transfected with 18μg of the psPAX2 (Addgene #12260) and 6μg of the pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene 54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Cell Biology 2023Quote: Entry clones were transferred using Gateway technology into a mammalian expression pcDNA3.1 plasmid containing an N-terminal 3xFLAG-V5 tag (Addgene 87064) for the Target Accelerator Pan-Cancer Mutant Collection ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Neuroscience 2023Quote: ... University of North Carolina Vector Core) or an enhanced yellow fluorescent protein control (eYFP; N = 13, 6 males; pAAV5-Ef1a-DIO-eYFP, Addgene). Virus (0.2 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequences encoding N-KSR or C-KSR were subcloned into SfiI sites of pSBbi-pur-H-2Kb (# 111623, Addgene, USA) replacing an existing H-2kb fragment ...
-
bioRxiv - Cell Biology 2023Quote: ... The pCAG-V5-TurboID vector was constructed by inserting the amplified TurboID cDNA containing the V5 epitope (GKPIPNPLLGLDST) sequence at the N-and C-terminal sites into the pCAGGS expression plasmid (Addgene). Expression plasmids encoding V5-TurboID-Solo and Solo-TurboID-V5 were constructed by inserting amplified Solo cDNA with a GS-linker (GGGSx2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4–1026 bp for the N-terminus and 2578–4563 bp for the C-terminus) was subcloned into C-Flag-pcDNA3 (Addgene, plasmid # 20011 ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Neuroscience 2024Quote: ... 7- to 9-week-old male Avpr1b-cre mice and WT mice (n= 24) were injected with 150 nL of the Cre-dependent AAV2-hSyn-DREADD-Gi-mCherry (#44362-AAV2, Addgene) at 5 x 10%+ transducing units per ml at the same coordinates.
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SnoopTag-AffiHER2-SpyTag (N-terminal His6–SnoopTag–anti-HER2 Affibody–SpyTag) (GenBank accession no. KU296975) (Addgene deposition in progress) (Brune et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Developmental Biology 2022Quote: Sufu KO #2 was transfected with 2 μg of either 1436 pcDNA3 Flag HA (Addgene plasmid: 10792), a pcDNA Flag HA vector with the Sufu open reading frame cloned from pcDNA Su(fu ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...