Labshake search
Citations for Addgene :
1 - 50 of 2977 citations for 4 1 1 2 3 3 3 Hexafluoropropoxy acetophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Developmental Biology 2021Quote: ... U6-1 and U6-3 (Addgene plasmid #83954 ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cancer Biology 2024Quote: WNK1 depletion by CRISPR-Cas9 editing was done by using two independent gRNAs targeting Exon-1 (5’-CGCCGACGCTGTGACCGGC-3’) and Exon-4 (5’-ACTTACACTGGTCACGCGA-3’) cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector (Addgene #67974). TET-ON-Cas9 expressing cells were infected and BFP-positive cell FACS sorted ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... myofibers at differentiation day 3-4 were infected using 1 μl/ml of the AAV9-pAAV.CAG.GCaMP6s.WPRE.SV40 (Addgene viral prep # 100844-AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Immunology 2024Quote: ... the oligo targeti ng NAIP (5’-CCGGGCCGTGGTGAACTTTGTGAATCTCGAGATTCACAAAGTTCACC ACGGCTTTTTG-3’ and 5’-AATTCAAAAAGCCGTGGTGAACTTTGTGAATCTCGAGA TTCACAAAGTTCACCACGGC-3’) was cloned into pLKO.1 puro (8453, Addgene), w hich was then used for lentiviral construct as above ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Immunology 2024Quote: ... and pGEX-4T2-14-3-3 tau (θ) (Addgene #13281) were gifts from Michael Yaffe (Yaffe et al ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Genetics 2024Quote: ... along with 3 µg of pMXs.hOct4 (Octamer-Binding Protein 4, RRID:Addgene_17217), pMXs.hSox2 (SRY-Box Transcription Factor 2 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 I224A/L227A/W276A/I279A/I307A/V310A (ΔLIR1+3+4) (RRID:Addgene_223756). After the transformation of the pET-DUET1 vector encoding BCL2L13-GST wild-type or mutants in E ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...