Labshake search
Citations for Addgene :
151 - 200 of 963 citations for 3 methy 5 isobutylhydantion since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Neuroscience 2024Quote: ... From 5’ to 3’ the constructs consist of a Tet-On doxycycline inducible promoter (a gift from David Root (Addgene plasmid # 41393 ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Genetics 2021Quote: mks-3::gfp transgenes were generated with PCR-based fusion of mks-3 gDNA (including 485 bp of 5’ UTR sequence) with GFP (pPD95_77, gift from Andrew Fire, Addgene plasmid #1495). All primers are listed in Table S4 ...
-
bioRxiv - Genetics 2020Quote: Flies expressing a gRNA targeting the rosy (ry) locus (5’-CATTGTGGCGGAGATCTCGA-3’) were generated by cloning the gRNA sequence into the pCFD3 plasmid (Addgene #49410) as in [44] ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5’–CACCTTTGCCACTCTCAAAGGGGA-3’ and sgRNA REV: 5’-AAACTCCCCTTTGAGAGTGGCAAA-3’) was cloned into a BbsI digested pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid (42230; Addgene, Cambridge MA). Template DNA for in vitro transcription was generated by PCR amplification of the gRNA sequence—which included both the guide sequence as well as the scaffold sequence encoded in the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid—using Phusion HF DNA polymerase and a primer set (synthesized by IDT ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence (5’-GCCCAATTCAGAGAGACATG-3’) targeting the genomic region immediately downstream the CDK12 start codon was cloned into the PX458 vector (Addgene 48138). The 3xFLAG knock-in repair template was constructed in a pTOPO-TA vector (Mei5bio ...
-
bioRxiv - Cell Biology 2021Quote: A gRNA targeting the second exon of mouse Tubb6 gene (5’-CGACCAGGCCGGAGGCTACG-3’) was designed and cloned in lentiCRISPRv2 (Addgene, 52961). Empty and Tubb6 gRNA-containing lentiCRISPRv2 were used to produce lentiviruses ...
-
bioRxiv - Neuroscience 2020Quote: ... targeting exon 3 of the Prnp gene (5′-TCA GTC ATC ATG GCG AAC CT −3′) was cloned into the pKLV-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene 50946,) to generate pKLV-Prnp sgRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: ... Oligo nucleotides containing CRISPR target sequences (5’-CCGGCCGGGCCTACGGCTTG-3’) were annealed and ligated into pSpCas9 (BB)-2A-GFP (PX458) (Addgene 48138). Then ...
-
bioRxiv - Microbiology 2021Quote: An sgRNA (5’-ATCACAACGATCTGTTCGTC-3’) targeting the LGMN gene was cloned into the PX459 plasmid (Addgene plasmid #62988 from Feng Zheng51) encoding Cas9 and puromycin resistance ...
-
bioRxiv - Immunology 2022Quote: The CRISPR target site for murine p53 (single guide (sg) RNA: 5’-CTGAGCCAGGAGACATTTTC-3’) was already cloned into a px330 plasmid (px330-U6-Chimeric_BB-CBh-hSpCas9, Addgene plasmid #42230) and for human p53 (sgRNA ...
-
bioRxiv - Immunology 2022Quote: ... and for human p53 (sgRNA: 5’-GCATCTTATCCGAGTGGA-3’) was already cloned into a px459 plasmid (pSpCas9(BB)-2A-Puro (px459) V2.0 (Addgene plasmid #62988)) and kindly provided by Daniel Hinze from the lab of Michael Hölzel ...
-
bioRxiv - Cancer Biology 2022Quote: ... GCAAGATGATCCCAATGAGT) or Ifngr2-targeting sgRNAs (3’-gRNA-‘5: AGGGAACCTCACTTCCAAGT) were cloned into target vector px458-pSpCas9(BB)-2A-GFP (Addgene #48138) or px459-pSpCas9(BB)-2A-Puro (Addgene #62988) ...
-
bioRxiv - Cell Biology 2022Quote: ... The guide with the highest ranking in both scoring programs (5’-CGGCGCAACAGGTCGCGAACGGG-3’) was selected for cloning into the PX459 vector (Addgene, #62988), a non-lentiviral construct that also delivers Cas9.74 Oligos containing the gRNA sequences (5’-CACCGCGGCGCAACAGGTCGCGAAC-3’ and 5’-AAACGTTCGCGACCTGTTGCGCCGC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... Two single gRNA vectors containing either the 5’ or 3’ UTR-targeting gRNA were then generated using the pSAG1::Cas9-U6::sgUPRT plasmid as a backbone (Addgene #54467)5 ...
-
bioRxiv - Immunology 2019Quote: ... Guide RNA sequences targeting NLRP3(5’-gtcctcctggcataccatag-3’) with BsmbI sticky end were annealed and inserted into the lentiviral vectors pLenti-CRISPR v2(Addgene #52961) digested with BsmBI (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCTCGTTCAGCACGGCCTCCA and reverse 5’- aaacTGGAGGCCGTGCTGAACGAGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987). To knock in eGFP into either the MFF or FIS1 loci ...
-
bioRxiv - Cell Biology 2020Quote: ... forward 5’- CACCGCATTTAAATACAGTAAATAC and reverse 5’- aaacGTATTTACTGTATTTAAATGC-3’) were cloned into pSpCas9n(BB)-2A-Puro (PX462) V2.0 (a gift from Feng Zhang (Addgene plasmid # 62987)10.
-
bioRxiv - Immunology 2020Quote: We using the 3*Flag sequence to replace the GFP protein in the pLenti CMV GFP Puro vector (Addgene, 658-5) for adding some Restriction Enzyme cutting site (XbaI-EcoRV-BstBI-BamHI ...
-
bioRxiv - Cancer Biology 2019Quote: ... a 20-mer sgRNA target sequence (5′-CTCAGAGGGGGCTCGACGCT-3′) at exon 2 of the TP53 gene was designed (28) and cloned into pX330 (Addgene #42230), which was a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... Pairs of guide RNAs targeting upstream (5’) and downstream (3’) flanking sequences were designed and cloned into LentiCRISPRv2-GFP (Addgene #82416) and LentiCRISPRv2-mCherry (#99154 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2024Quote: ... The protein-coding sequence was codon optimized and flanked by HindIII (5’) and NotI (3’) restriction sites for cloning into a pCMV plasmid (Addgene #60360). A hemagglutinin (HA ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... of 14-3-3 theta into pEBFP2-C1 (Addgene plasmid #54665). A CHIP plasmid78 was a gift from Leonard Petrucelli and the CHIP ORF was cloned into pCMV-C2-6myc ...
-
bioRxiv - Molecular Biology 2021Quote: ... Laccase2 Exons 1-3 (Hy_pMT Laccase2 Exons 1-3; Addgene #91799), and nLuc (Hy_pMtnA nLuc SV40 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP-Galectin-3 was subcloned from ptf-Galectin-3 (Addgene: 64149). pMXs-puro eGFP-p62 was a gift from Noboru Mizushima (Addgene plasmid # 38277 ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.