Labshake search
Citations for Addgene :
1 - 50 of 1564 citations for 3 2 Bromophenyl 9 phenyl 9H carbazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Cultured Cdh11 wild-type and knockout hippocampal neurons (300,000 cells/2 cm2) were transfected at 3 DIV or 9 DIV with the pLL3.7-GFP vector (Addgene Cat#11795) using Lipofectamine 2000 (Invitrogen Cat#11668-019 ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2024Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: The plasmid WPRE-ab (pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA) was obtained from previous studies in our laboratory (Addgene plasmid #190163). The plasmid CAG-eYFP-3x-miR708-5p-TS was a gift from Viviana Gradinaru (Addgene plasmid #117381 ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Genomics 2022Quote: ... 12 μg of plasmid library was cotransfected with 9 μg psPAX2 and 3 μg pMD2.G (Addgene #12260 and #12259) into HEK293FT cells using 72 μl Lipofectamine 2000 (Life Technologies #11668019) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (300 nL; 3×1011 GC/ml; Serotype:9; Addgene, Massachusetts, USA) was unilaterally injected into the right MePD using a 2-μL Hamilton micro syringe (Esslab ...
-
bioRxiv - Neuroscience 2024Quote: ... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
bioRxiv - Neuroscience 2024Quote: ... to express channelrhodopsin (ChR2) or control virus (n = 4, AAV-Ef1a-fDIO-mCherry, 200 mL, 3 × 1012 GC/mL; Serotype: 9; Addgene) was unilaterally injected over 10 minutes into the MePD using a 2-µL Hamilton microsyringe (Esslab ...
-
bioRxiv - Cancer Biology 2020Quote: ... 9 μg pMD2.G (Addgene #12259) and 3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... with GFP1-9::iRFP702 (Addgene #130125), mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega) ...
-
bioRxiv - Physiology 2023Quote: ... and 9 μg of psPAX2 (Addgene), 6 μg of psPAX2 (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 μg pUMVC plasmid (Addgene, 8449), and 3 μg pCMV-VSV-G plasmid (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2021Quote: ... Four rats were injected into the right FC with 0.02 μL of AAV2/9-CaMKII-hChR2(E123A)-mCherry-WPRE.hGH (Catalog #AV-9-35506; Addgene plasmid #35506 ...
-
bioRxiv - Genetics 2022Quote: ... 9 µg psPax2 packaging plasmid (Addgene #12260), and 1 µg VSV-G envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2/9-FLEX-tdTomato (Addgene, #28306-AAV9). For chronic window implantation ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9 helper (Addgene plasmid #112865, 9 μg/dish), and the AAV expression vector (12 μg/dish) ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Bioengineering 2024Quote: HeLa cells expressing mCherry-coupled galectin-9 (mCherry-GAL9) were obtained by transfection using plasmids encoding mCherry-galectin 9 (Addgene, Watertown, MA). The galectin-9 reporter HeLa cells were then cultured in ibidi μ-slide 8 well glass bottom chamber at a density of 2x104 cells/well and grew overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 9 μg of psPAX2 packaging vectors (Addgene #12260) using polyethylenimine (Polysciences ...
-
bioRxiv - Neuroscience 2024Quote: ... serotype 9 (AAV9) expressing GCaMP6s (AAV9.CAG.GCaMP6s.WPRE.SV40, Addgene, USA) was injected subcutaneously in the nape of the neck of pups (P2-P6) ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9). Assignment of AAV was counterbalanced for sex ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...