Labshake search
Citations for Addgene :
1 - 50 of 2774 citations for 2 6 Di 1 tert butyl 1 1 diphenylsilyl oxy 9 10 dihydroanthracene 9 10 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... and for luciferase assays a ratio of 1:9:10 HA-Clover plasmid:pcDNA(-):HRE-Luciferase (Addgene #26731) was used (physiological expression levels) ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 nL of AAV2/9-hSyn-GCaMP6s (Addgene, titer ≥ 1×1013 vg/mL) was pressure injected into each ocular vitreous through a glass micropipette using a Nanoject (Drumond Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
bioRxiv - Neuroscience 2020Quote: pFL - AAV-9: pGP-AAV-syn-GCaMP6f-WPRE.24.693 at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Neuroscience 2024Quote: ... cohort 1) or AAV9.EF1a.dflox.hChR2(H134R).mCherry.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2).
-
bioRxiv - Cancer Biology 2023Quote: ... pLKO.1 and pLKO.5 were sourced from Addgene (#1864; a gift from David Sabatini 9) and Sigma-Aldrich (St ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Neuroscience 2022Quote: ... versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459; titer: 9 × 1012 gc/ml). To ablate PVNOT neurons ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 9 μg pMD2.G (Addgene #12259) and 3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Physiology 2023Quote: ... and 9 μg of psPAX2 (Addgene), 6 μg of psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... with GFP1-9::iRFP702 (Addgene #130125), mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega) ...
-
bioRxiv - Biochemistry 2024Quote: ... 9 μg pUMVC plasmid (Addgene, 8449), and 3 μg pCMV-VSV-G plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Neuroscience 2022Quote: ... or rAAV2/9 encoding for NIR-GECO2 under control of the synthetic CAG promoter (0.5 × 1012 -1 × 1013 gc/ml; AddGene plasmid #159603 ...
-
bioRxiv - Neuroscience 2021Quote: ... Four rats were injected into the right FC with 0.02 μL of AAV2/9-CaMKII-hChR2(E123A)-mCherry-WPRE.hGH (Catalog #AV-9-35506; Addgene plasmid #35506 ...
-
bioRxiv - Genetics 2022Quote: ... 9 µg psPax2 packaging plasmid (Addgene #12260), and 1 µg VSV-G envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Developmental Biology 2024Quote: ... Each dsDNA was injected into CB4088 hermaphrodites at a final concentration of 10 µM with 9 ng plasmid pCFJ90 (Addgene #19327, myo-2>mCherry::unc-54 ‘UTR) as an injection marker ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2/9-FLEX-tdTomato (Addgene, #28306-AAV9). For chronic window implantation ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9 helper (Addgene plasmid #112865, 9 μg/dish), and the AAV expression vector (12 μg/dish) ...
-
bioRxiv - Molecular Biology 2024Quote: A non-targeting ‘scramble shRNA’ control sequence and two L1-ORF1-targeting shRNAs [9] were cloned into pLKO.1-TRC (Addgene #10878):
-
bioRxiv - Cancer Biology 2024Quote: ... and pCDH-FLT3L-CAR transferring lentiviral vector as previously described.9 Immortal THP-1 monocytic cells were first transduced with mCherry-encoding lentivirus (Addgene #176016) and sorted by FACS (BD FACSaria FUSION) ...
-
bioRxiv - Bioengineering 2024Quote: For transgene expression studies with AAV vectors we used the following AAV expression plasmid:pAAV/mIba1.GFP.WPRE.miR-9.T.miR-129-2-3p.T.SV40pA was a gift from Hirokazu Hirai (Addgene plasmid # 190163 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... plasmid was created by Infusion cloning of CMV-GFP(1-10) from pcDNA3.1-GFP(1-10) (a gift from Bo Huang (Addgene plasmid # 70219) into a pUC57 backbone ...
-
bioRxiv - Bioengineering 2024Quote: HeLa cells expressing mCherry-coupled galectin-9 (mCherry-GAL9) were obtained by transfection using plasmids encoding mCherry-galectin 9 (Addgene, Watertown, MA). The galectin-9 reporter HeLa cells were then cultured in ibidi μ-slide 8 well glass bottom chamber at a density of 2x104 cells/well and grew overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μL of AAV-PHPeB-hsyn-cre-eGFP (Addgene#105540, titer ∼1×10^13) or AAV-PHPeB-CAG-GFP (Addgene#37825 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 9 μg of psPAX2 packaging vectors (Addgene #12260) using polyethylenimine (Polysciences ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9). Assignment of AAV was counterbalanced for sex ...
-
bioRxiv - Neuroscience 2024Quote: ... serotype 9 (AAV9) expressing GCaMP6s (AAV9.CAG.GCaMP6s.WPRE.SV40, Addgene, USA) was injected subcutaneously in the nape of the neck of pups (P2-P6) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μL of AAV9-hsyn-cre-2a-tdT (Addgene#107738, titer ∼1×10^13) was diluted with 3 μL of PBS and was injected into the subarachnoid space of one hemisphere at the level of somatosensory cortex in Mtor-floxed-5XFAD mice ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...