Labshake search
Citations for Addgene :
1 - 50 of 1732 citations for 2 Trimethylsilyl Furo 3 2 B Pyridine 6 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.1.7 (Addgene, #170451), SARS-CoV-2 B.1.351 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.351 (Addgene, #170449), SARS-CoV-2 P.1 (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 B.1.167.2 (Addgene, #172320), SARS-CoV-2 B.1.1.7 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907) were kindly shared by Dr ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... plasmids pTwist-SARS-CoV-2 d18 B.1.617.2v1 (Addgene #179905) and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cancer Biology 2020Quote: WT RPA1/2/3 and GFP were overexpressed in the PRMT5 KO cell line by co-transfection of WT RPA1/2/3 (Addgene) and pCMV-GFP plasmid with 5:1 ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNAs 5’-CCCCATGGACATACCCACTG-3’ and 5’-CCAGTCGAGCAGAAAAGTGT-3’ defining a 244 bp region in Nodal exon 2 were cloned into pX458 (Addgene plasmid #48138) or pX459 (Addgene plasmid #48139 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Cancer Biology 2024Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Developmental Biology 2024Quote: ... Sense and antisense double strands of the targets A and B (see Supplementary Table 2) were cloned into pU6-BbsI-chiRNA (Addgene #45946) [47] for production of single stranded guide RNAs (sgRNAs ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Biophysics 2024Quote: ... in combination with pBV-Luc BDS-2 3x WT (pBDS-2) (BDS-2 3x WT (p53 binding site) was a gift from Bert Vogelstein (Addgene plasmid #16515 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...