Labshake search
Citations for Addgene :
1 - 50 of 243 citations for 192 IgG Mouse Monoclonal Cy3 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2024Quote: ... Opto-labeled dmPFC MP neurons were labeled with pAAV-CAG-hChR2-mcherry24 (Addgene viral prep # 28017-AAVrg) injected into motor cortex (A-P -0.6 ...
-
bioRxiv - Biophysics 2022Quote: ... mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene, 54281), Golgi apparatus labeled by GalT-GFP (plasmid was a gift from the Patterson Lab ...
-
bioRxiv - Biophysics 2022Quote: ... Cell endoplasmic reticulum (ER) was labeled by ERmoxGFP (Addgene, 68072), mitochondria labeled by mEmerald-Tomm20-C-10 (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Mitochondria mCherry fluorescent-labeled marker (mCherry-Mito) was obtained from Addgene plasmid repository #55146 ...
-
bioRxiv - Neuroscience 2021Quote: ... hSS were labeled with AAV-DJ-mDlx-GCaMP6f-Fishell-2 (Addgene, 83899) and placed in a well of a Corning 96-well microplate (Corning ...
-
bioRxiv - Neuroscience 2019Quote: ... we labeled interneurons by injecting AAV8-hDLX-GqDREADD-tdTomato (plasmid from Addgene; virus packaged at Boston Children’s Hospital viral core) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were labeled with mCherry using the pLV-mCherry vector (Addgene, 36084). EZ-Tet-pLKO- Puro was a gift from Cindy Miranti (Frank et al ...
-
bioRxiv - Neuroscience 2019Quote: ... excitatory and inhibitory neurons were labeled by transfection with CaMKII-eGFP (Addgene, 50469) and GAD1-mCherry (Genecopoeia ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding H2 IgG is available from Addgene; #190690 ...
-
bioRxiv - Cell Biology 2021Quote: GFP-labeled versions of dominant negative Rab14 mutant were from Addgene (Cat#49594 and 49593). GFP-hRab21(T31N ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines for use in orthotopic in vivo experiments were labeled with pHIV-luc-ZsGreen (Addgene). Bioluminescent imaging was performed every 3-7 days following intraperitoneal injection of D-luciferin and measured using the Xenogen IVIS Spectrum in vivo imaging system (PerkinElmer) ...
-
bioRxiv - Neuroscience 2023Quote: Projecting neurons were labeled with retrograde fluorescent tracers (Retrobeads, Lumafluor, and pAAV-CAG-tdTomato, Addgene 59462P). Fluorescent beads were stored at 4°C before use ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Neuroscience 2023Quote: ... Astrocytes were labeled for live assays prior to incorporation into miBrains using an AAV (pAAV-CAG-tdTomato, Addgene or AAV9-CAG-GFP ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP, 108vg/ml, Addgene #28304-PHPeB) at DIV 9-10 and processed for experiments 10-11 days later.
-
bioRxiv - Cell Biology 2021Quote: ... GFP-hRab21(T31N) (#1039) plasmid encoding GFP-labeled version of dominant negative Rab21 mutant was from Addgene (Cat# 83423). GFP-hRab22(S19N ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-hRab5B.dn3 (#1008) plasmid encoding GFP-labeled wild-type version of human Rab5B isoform was from Addgene (Cat# 61802). GFP-hRab5B(S34N ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were sparsely labeled by administration of AAVs (CamKII.Cre, 104vg/ml, Addgene # 105558-AAV9 and CAG.Flex.EGFP, 108vg/ml, Addgene #28304-PHPeB) at DIV 9-10 and processed for experiments 10-11 days later.
-
bioRxiv - Neuroscience 2023Quote: ... we first labeled odor responsive neurons with the permanent activity marker FLEX-RAM (Addgene # 84468, (Sørensen et al., 2016)) in-vivo ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Neuroscience 2020Quote: ... GABAergic projection neurons in the basal forebrain were retrogradely labeled using a unilateral injection of AAVrg-hSyn-DIO-eGFP in the OB (50 nL, Catalog #50457-AAVrg, Addgene), guided with a stereotaxic apparatus (Kopf ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines for use in orthotopic in vivo experiments were labeled with pLenti-PGK-V5-LUC Neo (Addgene plasmid #21471). The 293 cells were seeded in 10-cm-diameter dishes and transfected with pCMV-dR8.2 dvpr (Addgene plasmid #8455) ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cre-dependent GCaMP6s plasmid labeled with nuclear dTomato (pAAV-EF1α-DIO-GCaMP6s-P2A-NLS-dTomato) was acquired from Addgene (plasmid #51082). Cre expression plasmids ...
-
bioRxiv - Neuroscience 2020Quote: Cortical pyramidal neurons (CPN)s in WT and YAC128 cultures were labeled by transfecting a subset of neurons (1 of 2.7 million) with a cytoplasmic green fluorescent protein (GFP) (Addgene plasmid 37825) at the time of platting ...
-
bioRxiv - Cell Biology 2021Quote: ... CFP-hRab5C(S35N).dn3 (#1006) encoding Cerulean-labeled dominant negative mutant version of human Rab5C isoform was from Addgene (Cat# 11504). GFP-hEEA1 (#970 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...