Labshake search
Citations for Addgene :
1 - 50 of 710 citations for 11 Ketotestosterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... specifically: pETM-11 (AddGene) for Sar1 and pFASTBacHTb (AddGene ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Biophysics 2021Quote: ... and 11 μg packaging plasmid (psPAX2; Addgene #12260) using PEI at 2.5:1 (w/w ...
-
bioRxiv - Microbiology 2022Quote: ... and 11 μg of pMDLg/pRRE (Addgene # 12251) were co-transfected per tissue culture dish using Lipofectamine LTX reagent with PLUS reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Homology arms were cloned into pDD268 [11] (Addgene #132523) using NEBuilder Hifi DNA assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Developmental Biology 2020Quote: ... The expression vector pCAG-mNG2(11) were derived from pCAG-ERT2CreERT2 (Addgene #13777) (Matsuda and Cepko ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Microbiology 2019Quote: ... the pSLC recombineering series (11) which was a gift from Swaine Chen (Addgene plasmid # 73194), pON.mCherry (21 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pSFFV_mNG2(11)1-10 plasmid was a gift from Bo Huang (Addgene plasmid # 82610) (Feng et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 250μl per site at an 11-degree angle) with AAV5-EF1α-DIO-ChR2-eYFP (Addgene) to selectively target neuronal populations expressing Cre ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Genomics 2019Quote: ... two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDF0159 pCMV - huDisCas7-11 mammalian expression plasmid was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid #172507 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... The inserts of the pENTR™11 constructs were transferred into the lentiviral expression vector pInducer20 (Addgene, 44012) using Gateway cloning (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells (between passage 9-11) were transfected with lentiviral packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Biophysics 2022Quote: Escherichia coli NiCo21 (DE3) competent cells were transformed with the plasmid encoding sumo-tag fused DiCas7-11 (Addgene: 172503). A single colony was picked and transferred to 100mL LB media containing 50 μg/mL ampicillin and grown for 12 hours at 37°C before inoculation into 1L LB culture ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
-
bioRxiv - Molecular Biology 2023Quote: pDF0114 pu6-eco31i-eco31i-dis7-11-mature-dr-guide-scaffold was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid #186981 ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the U6-crRNA scaffold and the DiCas7-11 gene sequence from pDF0114 (Addgene #172508) and pDF0159 (Addgene #172507) ...
-
bioRxiv - Genomics 2020Quote: THP-1 and MV4;11 cells were engineered to stably express humanized S.pyogenes Cas9 endonuclease by lentiviral transduction with the FUCas9Cherry vector (Addgene 70182) and subsequent FACS-selection for mCherry-positive cells (THP-1-Cas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... For the mScarlet the human H2B clustered histone 11 (H2BC11) ( accession #NM_021058) was fused in frame without a linker and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Bioengineering 2023Quote: ... Human codon optimized DisCas7-11 protein sequence and the mature DR guide scaffold with golden gate sites were PCR amplified from Addgene plasmids # 172507 and #172508 ...
-
bioRxiv - Physiology 2024Quote: ... pLenti PGK Puro vectors expressing stable-HIF-11 (Plasmid #177202, addgene), pMD2.G (Plasmid #12259, addgene) and psPAX2 (Plasmid #12260, addgene) were ordered from Addgene.
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Microbiology 2024Quote: ... wells were transfected with 500 ng of RSV Gag-GFP (11) and 125 ng of FLAG-tagged Med26 (a gift from Joan Conaway and Ronald Conaway [Addgene plasmid #15367 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Retroviral vectors for JMJD6 expression were generated by cloning the Jmjd6 coding sequence with a C-terminal FLAG-tag sequence (11) into the pBABE plasmid vector containing the neomycin resistance gene (Addgene #1767). Mutant versions of JMJD6 were generated from the wild type construct using QuikChange Lightning site-directed mutagenesis kit (Agilent) ...
-
bioRxiv - Biophysics 2021Quote: ... were transfected in DMEM with 2 % (v/v) FBS with 12 μg of pHR-CMV-TetO2 construct vector alongside 11 μg envelope plasmid (pMD2.G; Addgene #12259) and 11 μg packaging plasmid (psPAX2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers containing this targeting sequence (primers 11 and 12) were annealed and subcloned into the pU6-(BbsI) CBh-Cas9-T2A-mCherry vector (Addgene #64324) digested with BbsI.
-
bioRxiv - Synthetic Biology 2022Quote: ... we generated the complement InterTag-BFP by inserting the sequence encoding for SpyTag002-sfCherry11 –TagBFP amplified from pSFFV-SpyTag-sfCherry2(11)-TagBFP (Feng et al. [53] Addgene #117485) into the membrane expression vector pDisplay (Addgene #34842 ...
-
bioRxiv - Neuroscience 2023Quote: ... The pSAD 11.G H2B:GFP was obtained by taking advantage of the pSAD 11.G F3 expression vector (kindly provided by M. Tripodi, Cambridge University, AddGene #32634). The nucleotide sequence encoding the histone H2B-tagged GFP was designed and ordered via GeneArts (ThermoFisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV-EF1α-DIO-GCaMP6m-WPRE-pA or pAAV-GfaABC1D-EGFP-WPRE-pA) with pAAV-RC2/11 (or pAAV-RC2-retro or pAAV-RC9) and pAdDeltaF6 (Addgene plasmid #112867) were co-transfected into HEK-293T cells at the molecular ratio of 1:1:1 ...
-
bioRxiv - Systems Biology 2022Quote: ... The nuclear marker H2B-miRFP703 is a fusion of the human H2B clustered histone 11 (H2BC11) with the monomeric near-infrared fluorescent protein miRFP703 (Shcherbakova et al. 2016) (Addgene plasmid #80001). ERK-KTR-mRuby2 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Immunology 2023Quote: Expi293F cells were cultured and transiently transfected with the pLenti-palmGRET reporter plasmid encoding the dual reporter palmitoylated EGFP-nanoluciferase protein (PalmGRET) (Addgene plasmid #158221 11) for EV production as described previously 23 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Plant Biology 2020Quote: ... These enhancers were inserted into the SacI, XbaI, XhoI, and SfoI sites of the plasmid pZS*11-yfp0 (Subramaniam et al., 2013) (Addgene #53241, https://www.addgene.org/53241/). The resulting plasmid (pZS*11_4enh ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...