Labshake search
Citations for Addgene :
401 - 450 of 1708 citations for KGF 2 FGF 10 Human 171a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Neuroscience 2020Quote: ... 10 animals received rejections of AAV5-CaMKIIa-hM4Di-mCherry (titer 9.5×10^12 GC/ml; Addgene, MA, USA), while eight animals received injections of a non-DREADD expressing viral control AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml ...
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry-Histone H2B-C-10 (Addgene #55057), and mCherry-LAMINB1-10 (Plasmid #55069 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg psPAX2 (Addgene plasmid #12260) were transfected to HEK293T cells seeded in a 15cm dish at 70% confluency ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µg pCMV-dR8.2 dvpr (Addgene 8455), and 10 µg sgRNA plasmid using X-tremeGENE™ 9 DNA transfection reagent (Roche 06365809001) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 μg of plasmid (pBABE-puro, Addgene #1764 or pBabe-puro Ras V12 ...
-
bioRxiv - Immunology 2020Quote: ... mCherry-Dectin1A-C-10 (Addgene plasmid # 55025), and mCherry-Dectin1A-N-10 (Addgene plasmid # 55026 ...
-
bioRxiv - Immunology 2020Quote: Emerald-Dectin1A-N-10(Addgene plasmid, #56291), Emerald-Dectin1A-C-10 (Addgene plasmid # 54057) ...
-
bioRxiv - Immunology 2020Quote: ... Emerald-Dectin1A-C-10 (Addgene plasmid # 54057), mCherry-Dectin1A-C-10 (Addgene plasmid # 55025) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10 µg VSV-G (Addgene #14888) in 2 ml Opti-MEM ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA 3.1-GFP1-10 (Plasmid #70219 Addgene) was used as the backbone to which a stop codon and a partial Kozak sequence together with the 11th part of GFP were added by reverse PCR using the blunt primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... TOMM20 (mCherry-TOMM20-N-10 Addgene 55146) and TFAM (pcDNA3-TFAM-mCLOVER Addgene 129574 ...
-
bioRxiv - Neuroscience 2023Quote: ... tdTomato-MAPTau-N-10 (Addgene plasmid #58113) and tdTomato-C1 (Addgene plasmid #54653) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µg of psPAX2 (Addgene, Plasmid #12260), 4 µg of pVSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μg of pX330-p53 (Addgene 59910), and 2.5 μg of CMV-SB13 transposase ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reference sgRNA library sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Cancer Biology 2020Quote: ... then the human codon optimized Cas13a coding sequence amplified from the pC013-Twinstrep-SUMO-huLwCas13a (Addgene) by PCR was cloned into pMD19-T-DMP to obtain pMD19-T-DMP-Cas13a,next the chemically synthesized U6 promoter sequence and the direct repeat sequence of guide RNA of Cas13a separated by BbsI restriction sites were cloned into pMD19-T-DMP-Cas13a ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Molecular Biology 2022Quote: Genome-wide CRISPR screening was performed using the Human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048). For sgRNA library transduction ...