Labshake search
Citations for Addgene :
401 - 450 of 1399 citations for IL 2 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Developmental Biology 2021Quote: ... The reference sgRNA library sequences for human GeCKO v2.0 (A and B) were downloaded from Addgene (https://www.addgene.org/pooled-library/) ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2019Quote: The cDNAs for protein expression in this study were as follows: human Tau-2N4R (Addgene #16316), human MAP7 (GE Dharmacon MGC Collection #BC025777) ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Cancer Biology 2020Quote: ... then the human codon optimized Cas13a coding sequence amplified from the pC013-Twinstrep-SUMO-huLwCas13a (Addgene) by PCR was cloned into pMD19-T-DMP to obtain pMD19-T-DMP-Cas13a,next the chemically synthesized U6 promoter sequence and the direct repeat sequence of guide RNA of Cas13a separated by BbsI restriction sites were cloned into pMD19-T-DMP-Cas13a ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Molecular Biology 2022Quote: Genome-wide CRISPR screening was performed using the Human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048). For sgRNA library transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids containing the coding sequences of human SLC46A1 (pDONR221_SLC46A1) and SLC46A3 (pDONR221_SLC46A3) were purchased from Addgene. Custom plasmids (pTwist-CMV ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Molecular Biology 2021Quote: Human Δ43GTPBP6 was cloned into the pET-derived vector 14-C (gift from Scott Gradia; Addgene plasmid #48309 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9 (hSpCas929,50; a gift from Peter Duchek (Addgene plasmid #59985 ...
-
bioRxiv - Neuroscience 2019Quote: ... ORFs from the human ORFeome collection were cloned into the pLEX307 destination plasmid (Addgene cat# 41392) using the standard LR clonase protocol (Thermo Fischer Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Cancer Biology 2021Quote: Neonatal human dermal fibroblasts (HDFns) were transduced with lentiviruses containing pCHAC-mt-mKeima (Addgene plasmid #72342) (Lazarou et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the human CAV1 fragment was further moved into a pET28-MBP-TEV plasmid (Addgene No. 69929) described in (37 ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a pair of single guide RNAs (sgRNA) targeting human TROP2 were inserted into lentiCRISPRv2 (Addgene, # 98293) and corresponding oligonucleotides were inserted into the pARv-RFP reporter vector (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Developmental Biology 2022Quote: ... A plasmid containing the full-length human FOS cDNA (NM_005252.4) was purchased from Addgene (Plasmid #59140). The full-length FOS cDNA was cloned into the pCS2 vector and FOS mRNA was generated using the mMessage mMachine Sp6 kit (Ambion ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual gRNAs (Table S2) against murine and human SMARCA4 were cloned into pLentivectorCRISPR v2 (52961, Addgene). Non-target control (NTC ...
-
bioRxiv - Cell Biology 2023Quote: ... Golgi localisation signal (residues 3131 to 3259 of Human Giantin) was extracted by PCR from Addgene’s plasmid #85048 ...
-
bioRxiv - Cell Biology 2023Quote: Lysosome localisation signal (residues 27 to 407 of Human LAMP1) was extracted by PCR from Addgene’s plasmid #55308 ...
-
bioRxiv - Bioengineering 2022Quote: ... Human PD-L1-GFP (pEGFP-N1/PD-L1) was a gift from Mien-Chie Hung (Addgene plasmid # 121478 ...
-
bioRxiv - Biochemistry 2023Quote: ... The human Archease gene spanning residues 27-168 was inserted into the 2M-T (Addgene: 29708) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid pET-TRSter for heterologous expression of human thioredoxin reductase (hTrxR) was purchased from Addgene. Plasmids for wt and mutant DJ-1 were obtained from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CD68 promoter and enhancer (hCD68, ∼800 bp) was subcloned from pcDNA3-hCD68prm (Addgene #34837). The mouse F4/80 promoter (mF4/80 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human cDNA and cloned into the LeGO-iG2 (kind gift from Boris Fehse, Addgene #27341). YIPF5 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Cell Biology 2023Quote: ... human ATAD1 was amplified from HEK293T cDNA and cloned into the pKH3 vector (Addgene plasmid #12555). The ATAD1 Walker B mutation (ATAD1E193Q ...
-
bioRxiv - Cell Biology 2023Quote: The genome-wide human GeCKO lentiviral sgRNA library v2 (kind gift from Feng Zhang, Addgene #1000000048), consisting of the 2 pools A and B ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with plasmid pLXSN16E6E7 encoding the human papilloma virus HPVE6E7 gene (Addgene #52394) as described [18] ...
-
bioRxiv - Molecular Biology 2024Quote: Human Kinome CRISPR pooled library (Brunello) was a gift from John Doench & David Root (Addgene #75314)10 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...