Labshake search
Citations for Addgene :
401 - 450 of 928 citations for FGF 4 Human 153a.a since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: The eGFP-CCDC32(FL, human) fragment in a pEGFP-C1 vector was purchased from Addgene (#110505) and then mutated to be siRNA resistant ...
-
bioRxiv - Neuroscience 2024Quote: ... human TDP-43 was subcloned out of a wtTDP-43tdTOMATOHA (gift from Zoushang Xu, Addgene # 28205) via XhoI and Kpn1 double digest and inserted into a pEGFP-N3 (Clontech ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were transduced with the Human CRISPR Knockout Pooled Library16 (Brunello, lentiCRISPR v2, Addgene 73179-LV) at ∼MOI 0.3 with 8 µg/ml polybrene ...
-
bioRxiv - Neuroscience 2020Quote: ... the fibroblasts were reprogrammed using the three plasmids (pCXLE-hOct3/4 [Addgene #27076] ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and pMD2G envelope plasmid (4 µg, a gift from Didier Trono; Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... 6 µg of 4:2:1:1 transfer:Gag-Pol (pMDLg-pRRE, Addgene):Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of each plasmid pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (Addgene #27078) ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMD2G envelope plasmid (4 μg, a gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Immunology 2023Quote: BMDMs grown on 4-well chamber were transfected with GEM-CEPIA1er (Addgene) (Suzuki et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 μg of pMD2.G (gift from Didier Trono, Addgene #12259) plasmids in Opti-MEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with plasmids expressing VSV-G (4 μg; Addgene #12259), Gag-Pol (3.375 μg ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which included ∼19,000 genes with 4 sgRNAs per gene and 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 C-terminal half (GST-LIC 389-523) was a gift from Ron Vale (Addgene plasmid #74599 ...
-
bioRxiv - Molecular Biology 2020Quote: ... which encodes the human codon-optimized Streptococcus pyogenes Cas9D10A nickase (hSpCas9D10A; a gift from Peter Duchek) (Addgene plasmid ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Neuroscience 2019Quote: Δe11- and +e11-Cacna1d splice variants were transiently expressed in human tsA201 cells with CaVβ3 (Addgene, 26574), CaVα2δ-1 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Genetics 2019Quote: ... The wildtype human DYRK1A cDNA was cut from the pMH-SFB-DYRK1A construct (Addgene, Cambridge, MA, USA) and inserted into pCS2-HA vector using XhoI and contains a gateway vector site 5’ to the cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... For CRISPR-mediated homologous recombination the human codon-optimized Cas9 expression plasmid was obtained from Addgene (41815). The sgRNA-GFP plasmid was obtained from Addgene (41819 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The sgRNA against human TSC2 gene 60 was subcloned into the lentiCRISPR v2 lentiviral vector (Addgene #52961). For lentiviral transduction ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Neuroscience 2021Quote: The immortalized human Schwann iHSC-1λ were infected with lentivirus derived from pLentiCRISPRv2 puro (Addgene, Cat#78852) expressing Cas9 and either a scrambled gRNA or one directed against the human NF1 gene designed to cleave between amino acids 157 and 158 in Exon 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... Mammalian cells were transfected with either the empty vector (pAAV) or human WT aSyn pAAV vector (Addgene plasmid # 36055 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178). The library was transformed into electrocompetent Lucigen Endura™ Escherichia coli (Lucigen ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Bioengineering 2020Quote: ... we used the human codon optimized Cas9 from lentiCRISPR v2 plasmid (Addgene 52961, Sanjana et al., 2014) as background for xCas9 and Cas9-NG mutations ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E. Perez-Reyes, Addgene #45810 (Gomora et al. 2002) in combination with green fluorescent protein.
-
bioRxiv - Cell Biology 2019Quote: ... lentiviruses were produced by transfecting human embryonic kidney (HEK)-293T cells with psPAX2 and pMD2.G (Addgene) and pLVX-puro-GFP-Lifeact viral vectors ...
-
bioRxiv - Neuroscience 2019Quote: Myc-Par3 was created by subcloning human myc-Par3 from the pK-myc-Par3b plasmid (Addgene #19388) into the peGFP-N2 vector as described above using BamHI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Cell Biology 2020Quote: Human Rab21 (aa 16-225) constructs were cloned into a Gateway destination vector pgLAP1 (Addgene plasmid #19702) to express Rab21 with an N-terminal GFP followed by a TEV cleavage site and an S-Tag in mammalian cells ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... CRISPR-cas9-based guide RNA (gRNA) targeting human EED (GATCATAACCAACCATTGTT) was cloned in LentiCRISPR v2 (Addgene 52961), which was mixed with psPAX2 and pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Microbiology 2020Quote: Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat and obtained from Addgene (#90294). It is a one-component library with guide-RNAs inserted in lentiCRISPRv2 backbone as well as the cas9 gene ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Microbiology 2022Quote: Human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) and amplified according to instructions ...
-
bioRxiv - Microbiology 2024Quote: The human CRISPR (clustered regularly interspaced short palindromic repeats) “Brunello” lentiviral pooled library was purchased from Addgene. The library version in the lentiCRISPRv2 backbone was chosen ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: CRISPR–Cas9 screen was performed using the whole genome human Brunello CRISPR knockout pooled library (Addgene #73178) (PMID ...
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Cell Biology 2023Quote: ... human RXRa cDNA was PCR-amplified from pSV-Sport-RXRα (a gift from Bruce Spiegelman; Addgene #8882)68 ...