Labshake search
Citations for Addgene :
401 - 450 of 2071 citations for 6 6 dimethyl 1 phenyl 6 7 dihydro 1H indazol 4 5H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Neuroscience 2020Quote: [4] QF2w-Hsp70frompQF2wWB(Addgene plasmid #61313) (Primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... psPAX2 (4 µg, Addgene plasmid # 12260) and pAdVAntage (1.6 µg ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μg of psPAX2 (Addgene #12260) and 8 μg of purified pLKO.1 plasmid containing the shRNA constructs upon reaching 70% confluency ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 μg of psPAX2 (Addgene, 12260), and 6 μg of GIPZ Non-silencing Lentiviral shRNA (control ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA targeting Pml exon 1 (Table 4) was subcloned into the pSpCas9 (BB)-2A-Puro plasmid (pX459v2, Addgene) and transfection of mESCs was performed using lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: Rats were anesthetized with isoflurane (induction: 4%; maintenance: 1–2.5%) and received either AAV8-hSyn-hM4Di-mCherry (Addgene #50475-AAV8) or AAV8-hSyn-mCherry (Addgene #114472-AAV8) ...
-
bioRxiv - Genetics 2019Quote: ... into the all-in-one lentivirus vector LentiCRISPRv2 (a gift from Feng Zhang; Addgene plasmid # 52961) (Sanjana et al. ...
-
bioRxiv - Cell Biology 2021Quote: Each pair of sgRNAs cloned into All-In-One (AIO) CRISPR/Cas9 nickase plasmids (#74119, Addgene) and sequences are shown in table 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mice were injected with one of the four viruses: rAAV1/EF1α1.1-FLPX-rc [Chronos-GFP] (Addgene plasmid #122102 ...
-
bioRxiv - Cancer Biology 2022Quote: CD73 gene-editing was generated by electroporation of all-in-one CRISPR/Cas9 vector (px330, Addgene) expressing the 20mer target sequence GCAGCACGTTGGGTTCGGCG (exon1) ...
-
bioRxiv - Cell Biology 2024Quote: ... one of the gRNAs was cloned into SpCas9(BB)-2A-GFP (px458) plasmid (Addgene; Cat #48138), and the other gRNA was cloned into the px330-mCherry plasmid (modified from Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... sgRNA sequences listed in Extended Data Table 7 were cloned into the lentiGuide-Crimson backbone (Addgene Plasmid # 70683). Non-replicating lentiviruses were generated by transient co-transfection of the transfer plasmids into HEK293T together with the packaging plasmids pMDL (Addgene Plasmid #12251) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Genetics 2020Quote: ... followed by incubation of annealed gRNA with 7 pmol of purified Cas9 (made after expression of Addgene #69090) [49] ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920; http://n2t.net/addgene:54920; RRID:Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 54967 ...
-
bioRxiv - Microbiology 2022Quote: Plasmids used in this study include mEmerald-Mito-7 (a gift from Dr. Michael Davidson (Addgene plasmid # 54160; http://n2t.net/addgene:54160; RRID:Addgene_54160)) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1; http://n2t.net/addgene:50465; RRID:Addgene_50465) were injected into the dorsolateral (100-200 nl ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54148 ; http://n2t.net/addgene:54148 ; RRID:Addgene 54148) For protein depletion ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids used in this study were as follows: YFP-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56596 ; http://n2t.net/addgene:56596 ; RRID:Addgene_56596), EGFP-DCX was a gift from Joseph Gleeson (Addgene plasmid # 32852 ...
-
bioRxiv - Neuroscience 2023Quote: ... The CMV::tdTomato-Lifeact-7 plasmid (abbreviated Lifeact throughout the manuscript) was a gift from Michael Davidson (Addgene plasmid # 54528 ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Neuroscience 2023Quote: ... mKeima-Red-Mito-7 was a gift from Michael Davidson (Addgene plasmid # 56018; http://n2t.net/addgene:56018; RRID:Addgene_56018) Transfections have been performed with Lipofectamin 3000 (Thermofisher ...
-
bioRxiv - Biophysics 2023Quote: ... The pT7-7 aSyn C141 plasmid was a gift from Gabriele Kaminski Schierle (Addgene plasmid #108866; RRID: Addgene_108866). After lysis with boiling ...
-
bioRxiv - Developmental Biology 2023Quote: ... TdTomato-LifeAct tdTomato-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54528 ; http://n2t.net/addgene:54528 ; RRID:Addgene_54528). Primers for all subcloned constructs are shown in Supplementary Table 8 ...
-
bioRxiv - Biochemistry 2023Quote: The pT7-7 α-syn WT plasmid (a gift from Hilal Lashuel, Addgene, Watertown, NY, United States (61)) ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were reprogrammed by a mixture of retroviral vectors encoding OCT3/4 (pMXs-hOCT3/4 Addgene: 17217), SOX2 (pMXs-hSOX2 Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: For mammalian 2-hybrid assays 2.15 x 105 HEK293 or 4 x 105 A375 cells were transiently transfected with 1 µg firefly luciferase reporter plasmid (5xGAL4-TATA-luciferase, Addgene, 46756) (Sun et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Cancer Biology 2024Quote: WNK1 depletion by CRISPR-Cas9 editing was done by using two independent gRNAs targeting Exon-1 (5’-CGCCGACGCTGTGACCGGC-3’) and Exon-4 (5’-ACTTACACTGGTCACGCGA-3’) cloned into pKLV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W backbone vector (Addgene #67974). TET-ON-Cas9 expressing cells were infected and BFP-positive cell FACS sorted ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLE-hOCT3/4-shp53-F (Addgene plasmid #27077 ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 μg psPAX2 packing plasmid (Addgene, 12260), and 0.8 μg pMD2.G envelope plasmid (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... and pCXLS-hOCT3/4 (Addgene plasmid #27076) episomal vectors (Okita et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4 μg of psPAX2 (Addgene plasmid # 12260), and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259 ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg hCas9 D10A (Addgene plasmid #41816) (Mali et al. ...
-
bioRxiv - Genetics 2019Quote: ... 4 μg of pMD2.G plasmid (Addgene), and 8 μg of psPAX2 (Addgene ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Insulin in pX330S-4 (Plasmid #58780, Addgene) and Glut2 in pX330S-5 (Plasmid #58781 ...
-
bioRxiv - Cell Biology 2019Quote: ... Lamin A-mEmerald (mEmerald-LaminA-N-18) and NLS-mCherry (mCherry-Nucleus-7) were gifts from Michael Davidson (Addgene plasmids #54139 and #55110 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Neuroscience 2021Quote: ... over V1 using an ultrafine dental drill and inserted a glass pipette backfilled with AAV2.1-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (titer: 7×1012 vg/mL, 20298-AAV1 Addgene). In total 50 nL was injected in V1 (bilateral binocular V1 for Task A and unilateral V1 for Task B ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml, viral prep #44361-AAVrg, Addgene, US,68). For canine adenovirus (CAV ...
-
bioRxiv - Biophysics 2019Quote: ... This α-actinin1-SNAP-His fragment was introduced downstream of the T7 promoter of pET T7-7 plasmid (Addgene).
-
bioRxiv - Biochemistry 2021Quote: The guide RNA sequence CAGAATTGGCGCTATGCTAC targeting exon 7 of FUT8 was cloned into px458 pSpCas9(BB)-2A-GFP (Addgene). The resulting plasmid was transfected into Huh7 cells using ViaFect (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... AAVrg-CAG-GFP (titer ≥ 7×1012vg/mL, category number 37825, lot V9234) was purchased from Addgene (Watertown, MA, USA).
-
bioRxiv - Bioengineering 2022Quote: ... To generate H2B-iRFP lentiviral particles HEK 293T cells were plated in a 6-well plate (7×105 cells per well) and transiently transfected with 1.5 μg of pLenti-pGK-DEST-H2B-iRFP vector (Addgene # 90237 ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.