Labshake search
Citations for Addgene :
401 - 450 of 2007 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Genetics 2024Quote: ... with the dU6:3 promoter from pCFD3 (Addgene #49410, [19]). A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041 ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Developmental Biology 2024Quote: ... Individual sgRNAs targeting sites 1-4 of the SABER array were cloned into 4 separate U6x:sgRNA plasmids (Addgene plasmids 64245-64248) as described previously52 ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Genetics 2021Quote: ... PiggyBac cargo plasmids used in Figure 3 and shown in Extended Data Figure 3 and pegRNA-expressing plasmids used in Figure 4 and Extended Data Figure 4 were created using the Mammalian Toolkit (Addgene article #2819751028), which was a gift from Hana El-Samad (UCSF).
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Neuroscience 2020Quote: ... These vectors are pCXLE- hOCT3/4-shp53-F (Addgene, Watertwon ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of pCMVR8.74 packaging vector (Addgene plasmid #22036) and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... described in(4) and obtained from Addgene (plasmid # 115809) to produce the HIV-1 LTR-eGFP virus ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene). Mice were also injected unilaterally in the mPFC (1.7 anterior-posterior (AP) ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1 μg pCXLE-hOCT3/4-shP53 (Addgene #27077) and electroporated using the Neon System (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-hDlx-GqDREADD-dTomato-Fishell-4 (Addgene, 83897-AAV9) viruses were injected in C57Bl6-Jax mice or in some cases in rats ...
-
bioRxiv - Neuroscience 2024Quote: pENN.AAV9.CamKII.4.eGFP.WPRE.rBG (Addgene viral prep # 105541-AAV9) was added to the cortical organoids at day 278 (1.68×108 GC/well) ...
-
bioRxiv - Synthetic Biology 2024Quote: pHB-4 was a gift from Kang Zhou (Addgene plasmid # 140957 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4) (RRID:Addgene_223781), BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4 ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2024Quote: ... or (1/8)NORAD-4xenv8- FL-3’antiPNA (Addgene plasmid #199209). For all experiments ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hCas9 (Addgene #41815; http://n2t.net/addgene:41815) using primers F_Cas9 and R_Cas9 ...
-
bioRxiv - Developmental Biology 2021Quote: ... or exon 3 of TET3 and cloned into pX330 vector (Addgene #42230) as previously described 47 ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Biochemistry 2021Quote: pCDEF3-hTIM-3 was a gift from Lawrence Kane (Addgene plasmid # 49212), and contained the natural variant L119 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg pBABE-neo largeT antigen cDNA (Addgene, 1780 ref (16))using lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Biochemistry 2020Quote: pHA#851: osm-10p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139208)
-
bioRxiv - Biochemistry 2020Quote: pHA#853: mec-4p∷Fynempty∷unc-54 3’UTR (Addgene ID: 139210)
-
bioRxiv - Biochemistry 2020Quote: pHA#850: osm-10p∷FynY531F∷unc-54 3’UTR (Addgene ID: 139207)
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... DCX DNA was cloned into the N-Terminal pFLAG 3 vector (Addgene) by restriction digest using NotI and BamHI restriction enzymes ...