Labshake search
Citations for Addgene :
401 - 450 of 3003 citations for 2 Aminomethyl 1 3 thiazole 4 carboxylic Acid Hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(I224A/L227A/W276A/I279A)-GFP (ΔLIR1+3) (RRID:Addgene_223780), BCL2L13(W276A/I279A/I307A/V310A)-GFP (ΔLIR1+4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 μg pCMV-VSV-G plasmid (Addgene, 8454) was used for each transfection ...
-
bioRxiv - Biophysics 2021Quote: ... we used the retinoic acid-responsive firefly luciferase expression vector pGL3-RARE-luciferase (Addgene plasmid #13458 ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Systems Biology 2022Quote: ... or 1-2 x 105 cells/mL for pCL040-based inducible protein expression vectors (to be deposited on Addgene) to account for differences in infection efficiency ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μl and 500 nl of AAV9-hSyn-GRAB-rDA1m (2 x 10^13 vg/ml; Addgene, 140556-AAV9) were injected into the dorsal striatum (AP 0.5 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/2 (Addgene, ref# 104963), AAV-GFP/Cre (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Bioengineering 2022Quote: ... respectively (Supplementary Data 4, Addgene #183903 and #183904). For piggyBac integration near the Ae ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 µg of pVSV-G (Addgene, Plasmid #8454), and 10 µg of lentiviral plasmid of interest were used ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µg of psPAX2 (Addgene, cat# 12260) using Lipofectamine 2000 Transfection Reagent according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4 injections of 5µl of AAV PHP.S (Addgene, 28306-PHP.S ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13 W276A/I279A/I307A/V310A (ΔLIR1+4) (RRID:Addgene_223755), BCL2L13 I224A/L227A/W276A/I279A/I307A/V310A (ΔLIR1+3+4 ...
-
bioRxiv - Cell Biology 2024Quote: ... The amino acid sequence of bPAC was obtained from pGEM-HE-h_bPAC_cmyc (Addgene plasmid #28134) (Stierl et al ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...