Labshake search
Citations for Addgene :
401 - 450 of 1544 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of pMtnA FLAG-IntS6 puro (Addgene #195076) or pMtnA FLAG-IntS12 puro (Addgene #195077 ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) AAV1.CAG.tdTomato (5.06×1012 GC/kg; Addgene #59462), 3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cell Biology 2024Quote: ... the pMD2.G packaging plasmid (2 µg, Addgene, #12259), and 3X polyethylenimine was added dropwise to the culture and incubated for 18 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: Sequence encoding SARS-CoV-2 S protein (Addgene #164433) was a gift from Alejandro Balazs ...
-
bioRxiv - Microbiology 2024Quote: SARS-CoV-2 expression plasmids were acquired from Addgene, courtesy of the contribution from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(Y213A/I216A/W276A/I279A)-GFP (ΔLIR1+2) (RRID:Addgene_223782), BCL2L13(I224A/L227A/W276A/I279A)-GFP (ΔLIR1+3 ...
-
bioRxiv - Cell Biology 2024Quote: ... a mixture of 2 μg pMD2.G (Addgene #12259), 8 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Sfp synthase (plasmid obtained from Addgene (pET-Sfp, #159617) and purified as described (Yin et al ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV8-EF1α-Con/Fon-oG (Addgene 131778, 5×1012 titer) were mixed in equal proportions (final titer = 2.5×1012 each ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/ Fon-TVA-mCherry (Addgene 131779, 5×1012 titer) and AAV8-EF1α-Con/Fon-oG (Addgene 131778 ...
-
bioRxiv - Molecular Biology 2024Quote: ... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was mixed with 4 μg of DNA RV helper plasmid (Addgene, plasmid #12371), in 1800 μl of Opti-MEM reduced serum medium (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... 200nL AAV-hM3D(G)q-mCherry (Addgene 44361-AAV8, 4×1012 vg/mL) was injected bilaterally at 50nl/min and mice were allowed 2 weeks recovery prior to testing ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were transfected with 0.5 μg of EGFP-PGC-1α FL (Addgene, #4) or ΔCTD for 24 h.
-
bioRxiv - Immunology 2023Quote: ‘CD44-isoform1-CD4d3+4-bio’ plasmid was obtained from Addgene (# 73098, Watertown, MA26). The extracellular region of CD44 was PCR amplified from this construct using primers listed in Supplementary Table S3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 μg of packaging vector psPAX2 (gift from Didier Trono (Addgene plasmid # 12260), 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(I224A/L227A/W276A/I279A/I307A/V310A)-GFP (ΔLIR1+3+4) (RRID:Addgene_ 223784), FUNDC1-GFP (RRID:Addgene_223737) ...
-
bioRxiv - Bioengineering 2020Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene Plasmid #141184) and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183 ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159). To express nsp10-14 and nsp14-10 fusion proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... or 2) the depolarizing opsin Channelrhodopsin (AAV1.EF1a.DIO.hChR2.EYF; Addgene) was expressed in a cre-dependent manner in interneurons using Gad2-IRES-Cre C57BL/6J mice (Jackson Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259) per well with LipoD293™ In Vitro DNA Transfection Reagent ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... we used the 2-vector system (lenti-guide Puro; Addgene #1000000049 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Sabatini lab (MIT) (Wang et al., 2; Addgene Catalogue # 51047). The libraries were amplified using published protocol at Addgene ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... using pcDNA3-SARS-CoV-2-RBD-8his (Addgene #145145, (33)) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Systems Biology 2024Quote: ... each promoter was transferred to the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259). Medium was changed 16 h after transfection and lentiviral particles were harvested 24 h later ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Developmental Biology 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-GAL4DBD-Hsp70 (Addgene #62904), pBS-KS-attB2-SA(0)-T2A-VP16AD-Hsp70 (Addgene #62905) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260) using Jet Pei reagent (Polyplus ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5 ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... and pTwist-SARS-CoV-2 d18 B.1.1.529 (Addgene #179907) were kindly shared by Dr ...