Labshake search
Citations for Addgene :
401 - 450 of 1731 citations for 1 4 Nitrophenyl cyclobutanecarbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and four small injections of a mixture of 1:20 AAV-hSyn-GCamP7f (104488-AAV9, Addgene, 1×10¹³ vg/mL) and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The vector pLenti X2 Blast/shp16 (w112-1) (Plasmid #22261) and pLenti X2 Blast/pTER shLUC (w618-1) (Plasmid #20962) were from Addgene.
-
bioRxiv - Biochemistry 2024Quote: ... An oligonucleotide corresponding to a target sequence near the smo-1 translational start site (sgRNA #1: 5‘ GCCGATGATGCAGCTCAAGC 3‘) was cloned into the plasmid pMW46 (derivate of pDD162 from Addgene). The deletion of the eleven amino acids ADDAAQAGDNA at the SMO-1 N-terminus was achieved using the oligonucleotide pAF64 as repair template ...
-
bioRxiv - Cancer Biology 2024Quote: Truncated CPSF6 containing amino acids 1-358 (CPSF6-358) from human isoform 1 was cloned into the pCW57.1 backbone (Addgene 71782). A hemagglutinin (HA ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-Ef1a-mCherry-IRES-Cre (1×1013 vg/ml #55632) and AAV2-CMV-EGFP (1×1013 vg/ml, #105530) were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... AAV-Ef1a- DIO-PPO-mVenus (AAV9, 1×1013 GC per ml), AAV-EF1a-fDIO-Cre (AAV8, 1×1013 GC per ml) were purchased from Addgene. rAAV9/CAG-FLEX-ArchT-GFP (4.7 × 1012 GC per ml) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-retro-EF1a-Cre (1 × 1013 gc/mL) and AAV5-CAG-DIO-EGFP-WPRE (Addgene #51502 1 × 1013 gc/mL) were bilaterally injected into the pons and the PL ...
-
bioRxiv - Cancer Biology 2024Quote: pENTR1A no ccDB (w48-1) and pLenti CMV Puro DEST (w118-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmid #17398 ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg pCAGGS-mCherry (Addgene, plasmid #41583) (45) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Using 1 ng pCFD6 (Addgene, Cat. No: 73915) as template ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μL of LSL-tdTomato (Addgene#: 100048); 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid pIRES2-eGFP (Addgene, Cat#6029-1) was used as transfection control ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCAFNF-tdTomato (Addgene#125575, 1 μg/μL) were used ...
-
bioRxiv - Microbiology 2020Quote: ... and pcDNA3.1-V5-hMcl-1 (Addgene plasmid #25375) were purchased from Addgene (Cambridge ...
-
bioRxiv - Genomics 2021Quote: ... and 1 µg of pMD2.G (Addgene, 12259) lentivirus packaging plasmids into 8 million HEK293T cells in a 10-cm dish with PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg pMD2.G (Addgene plasmid, 12259) combined with the overexpression vectors H2B-cherry ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Genomics 2023Quote: ... and 1 μg of pMD2.G (Addgene, 12259) packaging plasmids were cotransfected into 8 million HEK293T cells in a 10-cm dish supplemented with 36 μl PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cloning vector pLKO.1-TRC (Addgene, #10878) was used for shRNA expression ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX or pLKO.1 transfer plasmids (Addgene) using jetOPTIMUS according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Genetics 2024Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
-
bioRxiv - Cell Biology 2023Quote: ... For lentiviral transfections 1 μg VSVG (Addgene #8454) and 1.86 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2022Quote: ... together with 1 μg pVSV-G (#138479, Addgene) and 2 μg psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSV-1 UL12.5 was purchased from Addgene (#70109) and the EGFP was removed by subcloning ...
-
bioRxiv - Immunology 2022Quote: ... then ligated into pLKO.1 vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Cell Biology 2024Quote: ... plKO.1-TetON-Puro-Hif1a 0819 (Addgene 118704).
-
bioRxiv - Cell Biology 2024Quote: ... and the pLKO.1 plasmid (Addgene, Cambridge, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLenti CMV rtTA3 Hygro (w785-1) (Addgene: 26730), pCW57.1-4EBP1_4xAla (Addgene ...
-
bioRxiv - Immunology 2024Quote: ... and 1 μg of pRSV-Rev (Addgene #12253). 1 d after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV.Ef1a.DIO.EYFP (Addgene #27056-AAV5, 1×1012 vg/ml) was used as a control virus for the optogenetic real time place preference task ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV8.FLEX.tdT (1 × 1013 GC/mL, Addgene viral prep #28306-AAV8 ...
-
bioRxiv - Microbiology 2024Quote: ... into pENTR1A no ccdB (w48-1; Addgene #17398) previously modified to express N-terminal 3x Flag-tagged proteins (96) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 µg packaging plasmid psPAX2 (Addgene 12260) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLV-mCherry-hCdt1(1-100)ΔCy (Addgene #193759), and pCDH-EF1-mVenus-p27K− (Addgene #176651 ...