Labshake search
Citations for Addgene :
351 - 400 of 2434 citations for trans 2 2 4 Methoxyphenyl 2 oxoethyl cyclohexane 1 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... annealed in vitro and subcloned into BsmbI-digested lentiCRISPRv.2-puro (Addgene 52961) or lentiCRISPRv.2-hygro (Addgene 98291) ...
-
bioRxiv - Cell Biology 2022Quote: ... Number of pulses: 2×106 cells were transfected with ING2-PHD_GFP (Addgene, #21589) or pCSDEST2_NLS-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... or with both 2 μg mCherry and 6 μg pCBASceI (Addgene, Plasmid 26477). The cells were incubated overnight in 1 ml of media containing DMSO for the controls ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT Δ(2-15)-3F pCW57.1 was generated using the pCW57.1 (Addgene, #41393) plasmid backbone ...
-
bioRxiv - Cell Biology 2021Quote: ... 2×106 cells were transfected with 5ug pCBA-I-SceI plasmid (Addgene #26477), 40nmol siRNA and 1ug Cerulean-c1 plasmid (Addgene #54604 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene, 141368) were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ...
-
bioRxiv - Microbiology 2023Quote: ... All other SARS-CoV-2 viral protein-encoding plasmids were obtained from Addgene in the pLVX-EF1a-IRES-puro backbone (Addgene #141367-141370 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg envelope vector pMD2.G (gift from Didier Trono (Addgene plasmid # 12259) mixed in 0.45 mL water ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 μg of VSV-G envelope expressing plasmid (pMD2.G, Addgene #12259), and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G ...
-
bioRxiv - Genomics 2023Quote: ... and a “2 vector system” (backbone expresses only the sgRNA library – Addgene #73178). In this study we also used our Essential/Safe-havens library described above.
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150; http://n2t.net/addgene:49150; RRID:Addgene 49150) DNA was used to label the ER ...
-
bioRxiv - Genetics 2023Quote: ... 2 X 106 cells were co-transfected with 10 µg pT077 (Addgene 137879), 1.5 µg AAVS1 TALEN L (Addgene 59025 ...
-
bioRxiv - Neuroscience 2022Quote: (2) Chronic Window Implantation and Sparse Labeling: Viral vectors were purchased from Addgene. For viral injections and chronic window implantation ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Immunology 2022Quote: ... The replacement was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and one guide RNA that targeted the mouse Vκ3-7 segment ...
-
bioRxiv - Biochemistry 2023Quote: ... PDZ2 or PDZ1+2 tandem were obtained from Addgene (Tonikian et al., 2008) or purchased from GeneScript respectively and transformed into E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... we first obtained the CoV-2 genomic fragment from pSLQ5080_pHR_PGK_sfGFP_CoV-F2 (Addgene #155304) and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212 ...
-
bioRxiv - Cell Biology 2024Quote: mEos 2 Paxillin-22 was a gift from Michael Davidson (Addgene no, 57409).
-
bioRxiv - Microbiology 2024Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175, https://www.addgene.org/42175/; RRID:Addgene_42175) as template and the HA-coding sequence was included in one of the primer to generate a C-terminally HA-tagged IGF2BP2 ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 x 1011 viral genomes of PHP.eB-CAG-FLEX-GFP (Addgene #5150270) per animal ...
-
bioRxiv - Microbiology 2024Quote: ... and Illumina read 2 was generated from the plasmid pPEPZ-sgRNAclone (Addgene#141090) (de Bakker et al ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 µg of the SARS-CoV-2 Np coding plasmid (Addgene, cat.141391) was co-transfected as well ...
-
bioRxiv - Cell Biology 2020Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Bioengineering 2022Quote: ... sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS 2-6-3 were transduced with pLenti CMV rtTA3 Blast (w756-1, plasmid #26429; Addgene, gift from E. Campeau) for the expression of rtTA ...
-
bioRxiv - Neuroscience 2020Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Microbiology 2021Quote: Individual sgRNAs (sgLRRC15 #1: GACATGCAGGCACTGCACTG; sgLRRC15 #2: AGTGTCAGCCCGGGACATGC; sgACE2: GTTACATATCTGTCCTCTCC) targeting the candidate genes were cloned into linearized pXPR_502 (Addgene, #96923) for CRISPR activation ...
-
bioRxiv - Cell Biology 2022Quote: ... talin 2 shRNA-stable cells were co-transfected with Tln1 siRNA and EGFP-talin 1 head (Addgene plasmid no. 32856) or EGFP-talin 1 L325R (the mutant version ...
-
bioRxiv - Immunology 2020Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting DGAT1 (GE Dharmacon CAT# RMM4534-EG13350 - TRCN0000124791) ...
-
bioRxiv - Neuroscience 2020Quote: ... The loxP-NeoR-loxP cassette was inserted at the MluI site in the intron between exons 1 and 2 following PCR amplification from pL452 (Addgene) using primers 3-For and 3-Rev ...
-
bioRxiv - Immunology 2022Quote: ... with lentiviral packaging vectors pCAG-eco and psPAX.2 plus empty pLKO.1 control (EV) with a puromycin selection cassette (all obtained from Addgene) or a shRNA containing pLKO.1 targeting Cpt1a (GE Dharmacon CAT# RMM3981-201819967 – TRCN0000110596 ...
-
bioRxiv - Cell Biology 2022Quote: ... was constructed by recombining pENTR1a emGFP-Slc37a2 iso 2 with the pLenti PGK Hygro DEST (w530-1) vector (a gift from Eric Campeau and Paul Kaufman, Addgene plasmid # 19066 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Nsp1-NT (1-127 aa) and Nsp1-CT (128-180 aa) were amplified from pDONR207 SARS-CoV-2 NSP1 (Addgene) by PCR and then cloned into pDB-His-MBP or BacMam pCMV-Dest plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... injections of rAAV2-retro-Cre (produced by Salk Vector Core or Vigene, 2×1012 to 1×1013 viral genomes/ml, produced with capsid from Addgene plasmid #81070 packaging pAAV-EF1a-Cre from Addgene plasmid #55636 ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA oligonucleotides purchased from IDT were annealed and ligated in the BbsI restriction site of pX330A-1×2 (Addgene, #58766) plasmid to make pX330A-1x2-cNAT10 vector ...
-
bioRxiv - Cell Biology 2024Quote: ... we received plasmids encoding WT SARS-CoV-2 SP (Wuhan-Hu-1) and its receptor binding domain (RBD) from Addgene under a Material Transfer Agreement ...
-
bioRxiv - Genomics 2022Quote: pNLZ11 (Pfib-1::NLS::scFv::sfGFP::NLS::tbb-2 3′UTR) construct has the pCFJ210 vector backbone (Addgene plasmid # 19329). A codon-optimized scFv::sfGFP fragment [42] was ordered from IDT ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... Short hairpin RNAs (shRNAs) targeting WSB2 or BCL-2 family proteins were subcloned into the pLKO.1 puro vector (Addgene) for gene KD ...
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...