Labshake search
Citations for Addgene :
351 - 400 of 1751 citations for Vascular Endothelial Cell Growth Factor VEGF Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: T7 Express LysY competent cells transformed with plasmid pFGET19-Ulp1 (Addgene 64697) were grown to OD595 of 0.8 at 37°C in 2 L LB media supplemented with 50 μg/ml kanamycin (ON culture at 37°C without shaking) ...
-
bioRxiv - Biophysics 2021Quote: ... MDA-MB-231 cells were transfected with PD-L1-GFP (Addgene #121139) or PD-L1-GPF-C272A ...
-
bioRxiv - Cancer Biology 2020Quote: ... the NMRSF (LT)LTR cells generated using pBABE plasmid (Addgene plasmid # 14088) above were co-transfected with pPB-hyg-H RasV12 and PBase plasmids and selected with hygromycin ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (BL21DE3) expressing GST tagged anti-GFP nanobody (Addgene plasmid #61838) (Katoh et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Met4 cells were co-transfected with Mena gRNA and hCas9 (Addgene, #41824) using the Amaxa human keratinocyte Nucleofector kit (Lonza ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transfected with various plasmids: pCMV-VIVIT-GFP (Addgene, 11106), pCMV-p38-CA-EGFP and pCMV-eGFP-N1 (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with pMRX-IP-GFP-LC3-RFP-LC3ΔG (#84572, Addgene). 72 hours post transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then transfected with the EGFP-PH plasmid (Addgene Plasmid #96948), and stable EGFP-expressing B16 cells were selected by neomycin (G418 ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Cancer Biology 2021Quote: ... HEK 293FT cells were transfected with pRK5-TGFβRI-FLAG plasmid (Addgene, #14833) using Lipofectamine 3000 transfection kit ...
-
bioRxiv - Cancer Biology 2021Quote: HCT116 cells were transduced with lentivirus carrying KRAB-dCas9-BFP (Addgene #85969). Three days after transduction ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... DLD-1 cells were infected with pCLX-CHOP-dGFP lentiviruses (Addgene, 71299), single cell isolated ...
-
bioRxiv - Cell Biology 2022Quote: ... and cells were transfected with a mixture of pRSV-Rev (Addgene # 12253), pMDLg/pRRE (Addgene # 12251) ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were also transfected with ACE2 and TMPRSS2 expression plasmids (Addgene plasmid #141185 and #145843 ...
-
bioRxiv - Molecular Biology 2020Quote: ... U2OS cells were transfected with pSpCas9(BB)-2A-GFP plasmid (Addgene #48138) containing a short guide RNA targeting exon 7 in PRIMPOL gene ...
-
bioRxiv - Cancer Biology 2021Quote: NCI-H1876 cells that had been infected with lenti-Cas9Blast (Addgene #52962) and subsequently maintained in Blasticidin were used for the screen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3×106 HEK293T cells were transfected with 2.25 µg psPAX2 (Addgene, 12260), 1.5 µg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were first transduced with the dCas9 lentiviral construct (Addgene 61425-LV) and selected with 3μg/ml blasticidin ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with plasmids pEB-C5 and pEB-Tg (Addgene, USA) containing reprogramming factors OCT4 ...
-
bioRxiv - Cell Biology 2020Quote: ... HPC cells were transfected with a pHES1(467)-Luc (procured from Addgene) and internal control expressing the Renilla luciferase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cas9 coding sequence were integrated into the genome of cells (Addgene#52962) and selected with 1 μg/mL blasticidin for nine days ...
-
bioRxiv - Cancer Biology 2019Quote: ... A375 cells were transduced with lentiviral particles produced using vector pMH0001 (Addgene #85969 ...
-
bioRxiv - Biophysics 2020Quote: ... HeLa cells were transfected with 0.5 μg pSNAPf-C1 plasmid (Addgene 58186) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... the wildtype cells were nucleofected with pLJM1-EGFP plasmid (Addgene, Plasmid #19319) that has EGFP replaced with FcγRIIIa or FcγRIIIa(ITAM-/-) ...
-
bioRxiv - Molecular Biology 2019Quote: ... iCas9 cells were subsequently transduced with LentiGuide-puro lentiviral vector (Addgene #52963) bearing either empty guide RNA (gRNA ...
-
bioRxiv - Genetics 2020Quote: ... HUDEP-2 cells with stable expression of LentiCas9-Blast (Addgene plasmid 52962) were transduced at a low multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were transfected with 4 μg of pMD2.G (Addgene #12259), 4 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PANO2 and HEK293T cells with plasmids eGFP.KRASG12C-2B.retro.puro (Addgene ID 64372, RRID:Addgene_64372), eGFP.KRASG12C-2A.retro.puro (Addgene ID64373 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with 500 ng of LentiCrispR V2 (Addgene plasmid #52961) containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT ...
-
bioRxiv - Immunology 2021Quote: ... cells were co-transfected with 15ug of the pLKO.1_GFP (#30323, Addgene) vector containing OXSR1_Sh1 ...
-
bioRxiv - Immunology 2020Quote: Lentivirus was generated using HEK293T cells using packaging vector psPAX2 (Addgene#12260) and envelope plasmid encoding VSV-G ...
-
bioRxiv - Cell Biology 2020Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with the pX458 (pSpCas9(BB)-2A-GFP) plasmid (Addgene) carrying a GFP-tagged Cas9 and a guideRNA insert targeting both the K6a and K6b gene (guideRNA sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... TetR was expressed in cells using pLenti CMV TetR Blast (Addgene #17492). Transduced cells were selected with 5μg/ml blasticidin and bulk cells expressing the TetR protein were clonally isolated in 96-well plates using FACS (BD-Aria) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were labeled with mCherry using the pLV-mCherry vector (Addgene, 36084). EZ-Tet-pLKO- Puro was a gift from Cindy Miranti (Frank et al ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with plasmid pSpCas9(BB)-2A-Puro (PX459; Addgene, #62988) containing sgRNA against Yme1l (GATCCAATATGAGATGTATGCCAAC AAACGTTGGCATACATCTCATATT ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus were prepared by transfecting HEK293T cells with pRSV-rev (Addgene #12253), pMDL-RRE (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... 106 cells were nucleofected with 5μg of pCVL.SFFV.d14mClover.Ef1a.HA.NLS.Sce(opt).T2A.TagBFP (Addgene #32627) in 100μL electroporation buffer (Amaxa® Cell Line Nucleofector® Kit V ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected a second time with 2μg pCBASceI plasmid (Addgene #26477) using PEI (Polysciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... U2OS cells were transduced with lentiviral particles prepared with pCVL.TrafficLightReporter.Ef1a.Puro (Addgene #31482) at a low multiplicity of infection and selected with 2 μg/ml puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T packaging cells were co-transfected with pMDLg/pRRE (Plasmid #12251, Addgene), pRSV-Rev (Plasmid #12253 ...
-
bioRxiv - Cancer Biology 2022Quote: ... for generation of bulk PD-L2-KO cells or luciferase (Addgene #105621) to monitor in vivo bioluminescence following standard procedures ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with either a control pL-CRISPR.EFS.GFP (15µg, Addgene, 57818)78 or pL-CRISPR.EFS.GFP with cloned sgRNA sequences targeting Ascl1 (CRISPR1-F 5’CACCGCAACGAGCGCGAGCGCAACC-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: HEK293FT cells were transfected with pSIN-PAmCherry-KFERQ-NE (Addgene, Cat# 102365), pLP1 ...
-
bioRxiv - Cell Biology 2023Quote: ... lentivirus was produced by co-transfecting 293T cells with psPAX2 (Addgene; #12260), pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected Cos7 cells with Cx43-GFP (gift from David Spray (Addgene plasmid #69007 ...
-
bioRxiv - Cancer Biology 2023Quote: ... These cell lines were lentivirally transduced with SpCas9 (Addgene: #52962, Watertown, MA) and selected with blasticidin (InvivoGen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cas9-expressing cells were transduced in triplicate with a Lenti_sgRNA_EFS_GFP (Addgene #65656) lentivirus that co-expressed an sgRNA and GFP in 96-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... we produced lentiviruses in HEK293T cells using TLCV2 lentiviral vector (Addgene #87360) expressing a Tet-inducible CRISPR-Cas9 protein ...