Labshake search
Citations for Addgene :
351 - 400 of 3096 citations for Dengue Virus Serotype 3 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Neuroscience 2021Quote: ... the barcoded rabies virus plasmid library (131.36 mg) and CAG-promoter driven plasmids for T7 polymerase (23.66 mg, Addgene 59926) and SAD-B19 helper proteins (N ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nl of the adeno-associated virus (AAV) AAV1-SynGCaMP6s (diluted to 2.9×1012 GC/ml, Addgene 100844-AAV1) was injected into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Neuroscience 2020Quote: ... hippocampal slice cultures were microinjected in the CA3 area with an adeno-associated virus (AAV7 or AAV9) to express either ChR2 ET-TC60 (RRID:Addgene_101361) or ChrimsonR61 (RRID:Addgene_59171 ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus injections per mouse pup were in a total volume of 4μL of AAV9-syn-GCaMP6s (Addgene, MA, USA) with a titer of 1Χ1013 vg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: Brunello and Calabrese CRISPR guide virus libraries were obtained from the Broad Genomic Perturbation Platform (also available from Addgene). The pXPR_003 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pulled glass pipette front-loaded with virus carrying GCaMP6f (AAV1-hSyn-GCaMP6f-WPRE-SV40, 2.3 × 1013 gc/mL, catalog # 100837-AAV1, Addgene) was lowered into GC (1.9-2.0 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with 100 nL of AAV virus expressing GCaMP6s into three locations within primary visual cortex (AAV1.Syn.GCaMP6f.WPRE.SV40; Addgene 100837-AAV1) at two depths (150 and 300 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice that were cre-positive received the AAV-hM3D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice ...
-
bioRxiv - Cell Biology 2021Quote: Embryonic fibroblasts were generated from RHBDL4 WT and RHBDL4 KO E14.5 embryos and immortalized using lentiviral transduction of SV40 virus large T antigen (Ef1a_Large T-antigen_Ires_Puro, Addgene plasmid 18922), as described by Christova et al ...
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The viral vectors were generated by transfecting HEK293T cells using polyethylenimine with the packaging vector pCMV-dR8.91 and the vesicular stomatitis virus (VSV-G) envelope expression vector pMD2.G (#12259, Addgene) with either pLenti6.3/V5-DEST-TMPRSS2 (from UH Biomedicum Functional Genomic Unit ...
-
bioRxiv - Neuroscience 2021Quote: ... Adeno-associated virus containing the GCaMP7f gene (pGP-AAV9-syn-FLEX-jGCaMP7f-WPRE, 104488-AAV9, Addgene, Watertown, MA, USA) was loaded into a glass micropipette with a tip diameter of 40–50 µm attached to a Nanoject II injection system (Drummond Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... To achieve Tmem120a knockout in primary SVF cells loxP sites recombination was induced in vitro by the delivery of the Cre recombinase gene fused with GFP in AAV virus (RRID:Addgene_49056). As a control AAV with the GFP-only construct was used (RRID:Addgene_49055) ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus for expressing jGCaMP6f or jGCaMP7f under the synapsin-1 promoter (AAV1-syn-jjGCaMP6f-WPRE-SV40, Addgene, 100837 ...
-
bioRxiv - Neuroscience 2022Quote: ... we used stereotactically targeted virus injections of rAAV S1 FLEX-CAG-jGCaMP7s-WPRE (Lot v28549, Addgene, #104495 AAV-1) into the MSDB of 3— 6 months old ChAT-Cre mice ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV2-hSyn-DIO-EGFP retrograde virus construct (7.6×1012 genome copies/ml; 50457-AAVrg, Addgene, Watertown, MA, USA) was made with a flow rate of 1.0 µl/min ...
-
bioRxiv - Neuroscience 2022Quote: ... were injected with a virus for EYFP (AAV5-EF1a-DIO-EYFP-WPRE-hGHpA, Addgene, titer: 2E13 genome copies/mL) or received no injection ...
-
bioRxiv - Neuroscience 2023Quote: ... craniotomy was performed and an AAV virus (AAV9-CamKIIa-ChrimsonR-mScarlet-Kv2.1, which was a gift from Christopher Harvey via Addgene.org by63 was injected with a glass capillary using a stereotaxic robot (Neurostar GmbH ...
-
bioRxiv - Neuroscience 2023Quote: ... a mixture of flexed AAV GFP (pAAV-FLEX-GFP-Virus, titer ≥ 1×10¹³ vg/mL, Addgene 28304-AAV PHPeB) and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats received bilateral HPCv injection (300nL/side) of a Cre-dependent hM4Di-expressing virus (AAV2-Flex-hM4Di-mCherry; Addgene) using the same stereotaxic coordinates as the TRAP approach ...
-
bioRxiv - Neuroscience 2023Quote: ... a glass pipette (tip diameter: ∼100 µm) containing the retrograde AAV-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene #51085) was slowly lowered into the IC at a rate of 1 µm/s using a micromanipulator (Sutter MP-285) ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Neuroscience 2024Quote: ... 8 rats were bilaterally injected with DREADDs virus AAV5-CaMKIIα-hM4Di-mCherry (titer, 2.3×1013; Addgene http://addgene.org/50477) and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer ...
-
bioRxiv - Neuroscience 2024Quote: ... and 8 rats were bilaterally injected with AAV5-CaMKIIα-mCherry control virus (titer, 2.3×1013; Addgene http://addgene.org/114469).
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-EF1α::CVS-G (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #67528), AAV-DJ-EF1-DIO-tdTomato (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Cancer Biology 2024Quote: DIV06 rat cortical neurons were infected with AAV5 virus based on the AAV-Flex-TACasp3-TEVP plasmid (Addgene #45580)83 at a titer of >7x108 vg/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... TVA-oG-mCherry expressing glioblastoma spheroids were transduced with rabies virus constructs SAD-B19ΔG- eGFP(EnVA) or CVS-N2cΔG-eGFP(EnVA) (Addgene #73461) prior to further experiments.33 Transduced cells were sorted regularly by FACS with either FACSAria Fusion 2 Bernhard Shoor or FACSAria Fusion 1 Richard Sweet ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Cell Biology 2020Quote: ... and pET28a(+) (Addgene #69864-3), for His6-tag protein purification ...
-
bioRxiv - Systems Biology 2023Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2023Quote: - vector pGEX-4T-3 (Addgene_79149) to express only GST protein for alternative screening.
-
bioRxiv - Systems Biology 2024Quote: ... and pMW#3 (Addgene #13350) destination vectors using LR Clonase (ThermoFisher #11791100) ...