Labshake search
Citations for Addgene :
351 - 400 of 754 citations for Canine Adenovirus 2 Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Individual nsp10 was expressed from plasmid SARS-CoV-2 3xFlag-nsp5CS-nsp10 (Addgene ID 169157) containing the N-terminal 3xFlag tag (MDYKDHDGDYKDHDIDYKDDDDK) ...
-
bioRxiv - Biophysics 2021Quote: The plasmid with cDNA encoding SARS-Cov-2 spike HexaPro (S) was obtained from Addgene. To express the S protein ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G, Addgene #12259) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Genetics 2020Quote: ... we used an existing CMV-driven SARS-CoV-2 plasmid (pcDNA3.1-SARS2-Spike, Addgene 145032)(Shang et al. ...
-
bioRxiv - Microbiology 2021Quote: ... and pcDNA3.1 expressing SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Cell Biology 2019Quote: ... the guide RNA sequence (Supplemental Item 2) was cloned into the PX330 plasmid (Addgene #42230), which expresses S ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2021Quote: The plasmid encoding SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected organoids for 2 weeks with the AAV1-hSYN-eGFP virus (Addgene, 105539-AAV1), which directs expression of eGFP under the neuron-specific synapsin promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Molecular Biology 2024Quote: Neurogenin 2 (NGN2) was expressed in iPSC lines using a tetracycline inducible promoter (Addgene 172115) integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV.Syn.NES-jRGECO1a.WPRE.SV40 (Serotype 2/9; titer ≥ 1×1013 vg/mL) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...