Labshake search
Citations for Addgene :
351 - 400 of 3193 citations for 7H Pyrrolo 2 3 c pyridin 7 one 1 6 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Nslmb-vhhGFP4 coding sequence was amplified from pcDNA3-NSlmb-vhhGFP4 (Addgene plasmid #35579, (7)) by PCR and cloned into pCS2+ plasmid by Gibson assembly.
-
bioRxiv - Cell Biology 2020Quote: Plasmids for the expression of recombinant α-Syn were: pT7-7 α-Syn (Addgene plasmid #3604636 ...
-
bioRxiv - Biophysics 2020Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid # 54920 ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-eGFP (titer ≥ 7×1012 vg/mL; Addgene viral prep #50465-AAV5) as control ...
-
bioRxiv - Microbiology 2022Quote: Several plasmids were a kind gift from Nevan Krogan [7] (ORF8-Strep (Addgene #: 141390), Spike-Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920 ...
-
bioRxiv - Bioengineering 2023Quote: ... An existing plasmid was used for the expression of all 7 chaperones (Addgene #197589). For generating the DRUM or DRUMmut stable cell lines ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV-hSyn-DIO-mCherry (400 nl at titer 7×1012, Addgene, #50459-AAV5) as control ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 6 μg of psPAX2 packaging plasmid (Addgene plasmid #12260), and 2 μg pMD2.G envelope plasmid (Addgene plasmid #12259) ...
-
bioRxiv - Biochemistry 2020Quote: ... pDEST26-C-FLAG (Addgene #79275) [22] vector ...
-
bioRxiv - Biochemistry 2022Quote: ... mEmerald-JUP-C-14 (Addgene plasmid # 54132 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and c-Met (Addgene; 31784) plasmids were purchased from Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pOPARA2 or pPGC-C (Addgene plasmid # 174580 ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Cell Biology 2020Quote: ... was generated by ligating oligonucleotides containing the targeting sequence 5’-CAGTTCCTGGGTGGAGCTA-3’ into pLKO.1-puro (Addgene # 8453). The mitochondrial (CMV-mitoCAR-GECO1 ...
-
bioRxiv - Neuroscience 2023Quote: ... For transfection, 5 µg of DNA (4:3:1 of a transgene, pCMVdR8.74 (packaging plasmid; Addgene, Plasmid #22036) and pMD2.G (envelope plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9; http://n2t.net.addgene:26969; RRID; Addgene:26969 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999 ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Neuroscience 2021Quote: ... one DATcre mouse was injected with AAV8-hSyn-DIO-mCherry (Addgene, cat#50459) in midbrain (SNc ...
-
bioRxiv - Plant Biology 2023Quote: ... in one-step restriction-ligation reactions with a CaMV35sP-ΩTMV (pICH51277; Addgene #50268) and CaMV35sT (pICH41414) ...
-
bioRxiv - Cell Biology 2019Quote: ... HA-14-3-3σ (11946, Addgene) was transfected into skin keratinocytes in primary culture using the P1 Primary Cell 4D-Nucleofector™ X Kit (V4XP-1024 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 μg pMD2.G (Addgene #12259), 12 μg pCMV delta R8.2 (Addgene #12263) ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-ER-3 (Addgene plasmid #54082), and calnexin-mEmerlad (Addgene plasmid #54021 ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 μg pMD2.G (Addgene) were transfected into 293T cells at 80% confluency in a 10-cm dish with 8 ml of media ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 μg psPax vector (Addgene #12260), 1.5 μg pMD2.G vector (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... or Galectin-3-GFP (Addgene; [48]). The bacterial expression vector pZsGreen (Takara Bio USA ...
-
bioRxiv - Cell Biology 2021Quote: ... pCFJ104 (Pmyo-3::mCherry, Addgene #19328) and pGH8 (Prab-3::mCherry ...
-
bioRxiv - Bioengineering 2021Quote: ... 3 µg pMD2.G (Addgene #12259) and 9 µg lentiviral vector were diluted in 1.2 mL OptiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 3 μg psPAX2 (Addgene #12260) using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... and 3 μg psPAX2 (AddGene 12260) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... mCherry-ER-3 (Addgene, Watertown, MA), or Perilipin1-YFP[41] following established protocols[32] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg of psPAX2 (Addgene #12260), and 1.5 µg of the pMD2.G plasmid (Addgene #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nL of AAVrg-hSyn-GFP (Addgene 50465-AAVrg; titer 7×10^12 vg/mL) was injected unilaterally at a rate of 2nL/sec ...
-
bioRxiv - Neuroscience 2022Quote: ... or pAAV-hSyn-DIO-mCherry (Control mCherry reporter; Addgene #50459, titers: 7×1012 vg/ml) into the VTA ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-hM4D(Gi)-mCherry (serotype AAV retrograde, viral titer ≥ 7×1012 vg/mL; Addgene), and Clozapine N-oxide (CNO ...
-
bioRxiv - Cell Biology 2023Quote: Expression constructs used in this study include pCI-mScarlet (Addgene #85042; pC1-mScarlet-Syp [7]), pCIG2-GFP-MACF43 [42] ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Genomics 2023Quote: ... 7 μg of pUCmini-iCAP-PHP.eB (a gift from Viviana Gradinaru, Addgene plasmid #103005, RRID:Addgene_103005)24 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; virus titer ≥ 7×10¹² vg/mL) viruses were performed on adult anesthetized (isoflurane ...