Labshake search
Citations for Addgene :
351 - 400 of 3191 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Immunology 2020Quote: ... the lentiCas9-v2 lentivirus were produced from HEK-293FT cells transfected with the lentiCas9-v2 plasmid mixed at a 2:1:1 DNA ratio of the lentiviral packaging plasmids pMD2.G (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Topbp1 (shTopbp1 #1 and shTopbp1 #2) and a scramble control sequence (shScbl) were cloned into the pLKO.1-Hygro lentiviral vector (Addgene plasmid #24150). The lentiviral-containing medium was harvested from HEK293T cells at 48 h and 72 h after transfection ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either ArchT (N = 7; 4 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...
-
bioRxiv - Cell Biology 2019Quote: ... the oligos targeting Mouse Cep164 (5’-GGTGATCTTTACTATTTCA-3’) and Firefly Luciferase (5’-TGAAGTCTCTGATTAAGTA-3’) were cloned into the HpaI and XhoI restriction sites in pSICOR (Addgene RRID:Addgene_11579) (Ventura et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... Adapter sequences were added to the 5’ and 3’ sequences (5’prefix: TGGAAAGGACGAAACACCG, 3’suffix: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC) to allow cloning by Gibson assembly in the lentiCRISPRv2 vector (Addgene #52961). The oligos were synthetized as a pool by LC Sciences ...
-
bioRxiv - Cell Biology 2023Quote: ... The guide RNA targeting sequence 5’- TGGTCGTGGATACGAGAAGA-3’ was inserted into the Peft-3>Cas9 + sgRNA plasmid pDD162 [12] (Addgene #47549) using a Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing the FOXJ1 targeting sgRNA sequence 5’-GGGCCTTCTTGTAAGAGGCC-3’ or the CCDC40 targeting sgRNA sequence 5’-CTCCTCGTTGGCGGCTGCGCAGG-3’ with 1 μg of MBX plasmid (gift from Linzhao Cheng, Addgene plasmid #64122) and 1 μg of homemade donor plasmid pUC19_FOXJ1_mCherry_cNEO for the FOXJ1_mCherry tagging project were mixed with 4 μL of Lipofectamine and left at room temperature for 10 min to form complexes ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Microbiology 2019Quote: ... Plasmids mIFP12-Rab4a-7 (#56261) and mIFP-Golgi-7 (#56221) were purchased from Addgene.
-
bioRxiv - Bioengineering 2020Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene Plasmid #141184) and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183 ...
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 3xFlag-nsp5CS-nsp14 (Addgene ID 169159). To express nsp10-14 and nsp14-10 fusion proteins ...
-
bioRxiv - Neuroscience 2020Quote: ... or 2) the depolarizing opsin Channelrhodopsin (AAV1.EF1a.DIO.hChR2.EYF; Addgene) was expressed in a cre-dependent manner in interneurons using Gad2-IRES-Cre C57BL/6J mice (Jackson Laboratory) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μg of pMD2.G plasmid (Addgene plasmid # 12259) per well with LipoD293™ In Vitro DNA Transfection Reagent ...
-
bioRxiv - Genomics 2021Quote: ... 375 ng of Prime Editor-2 enzyme plasmid (Addgene #132776) and 125 ng of pegRNA plasmid were mixed and prepared with a transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2022Quote: ... we used the 2-vector system (lenti-guide Puro; Addgene #1000000049 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 2 μg of pMD2.G coat protein vector (Addgene plasmid #12259 ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... Sabatini lab (MIT) (Wang et al., 2; Addgene Catalogue # 51047). The libraries were amplified using published protocol at Addgene ...
-
bioRxiv - Biochemistry 2019Quote: ... 0.1 μg of the envelope plasmid (pMDG.2, RRID: Addgene_12259) and 0.9 μg of the packaging plasmid (psPAX2 RRID ...
-
bioRxiv - Immunology 2021Quote: ... and pcDNA 3.1-SARS-CoV-2 Spike (Addgene plasmid #145032) for 72 hours at 37°C under 5% (v/v ...
-
bioRxiv - Immunology 2021Quote: ... using pcDNA3-SARS-CoV-2-RBD-8his (Addgene #145145, (33)) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... pEGFP-ZO-2 was a gift from Marius Sudol (Addgene plasmid # 27422 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of Gag and Pol (pMDLg/pRRE, Addgene #12251), and 2 μg of VSV-G envelope expressing plasmid (pMD2.G ...