Labshake search
Citations for Addgene :
351 - 400 of 3044 citations for 6 Oxabicyclo 3.1.0 hexane 2 ethanol 4 4 difluoro 3 hydroxy 1S 1 α 2 bta 3 bta 5 α 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... A 1:2 viral mixture of pENN.AAV.CamKII 0.4.Cre.SV40 (Addgene, diluted 1:100,000) and pAAV-hSyn-DIO-EGFP (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Cell Biology 2023Quote: We synthesized gRNAs flanking exon 4 and 5 and cloned them into the gRNA cloning vector (Addgene # 41824) using Gibson assembly (New England Biolabs)[19] ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV-hSyn-Flpo-3×FLAG (no. 173047, Addgene), which has the hSyn promoter followed by Flpo with 3×FLAG C-terminal tag (OGS629 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5ng of a reference plasmid (pNL4-3, Addgene) was spiked in to each DNA preparation and used for qPCR normalization (Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 50 ng/µl Peft-3::Cas9 (Addgene 46168) and 2,5 ng/µl Pmyo-2::tdTomato ...
-
bioRxiv - Immunology 2021Quote: ... 3 μg of pIRES-eGFP plasmid DNA (Addgene) were digested with 250 U of Benzonase ...
-
bioRxiv - Neuroscience 2020Quote: ... and 3 µg VSVG packaging vector (Addgene, 8454) in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit ...
-
bioRxiv - Bioengineering 2020Quote: ... 3 μg pCMV-VSV.G (Addgene, Watertown, MA; #8454), and 4 μg CD19-CAR-GFP transfer plasmid (Bloemberg et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-Flpo (Addgene #125576, 3-10 ng/μL) and pCAFNF-tdTomato (Addgene#125575 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 with primers 1010.C5 and 1010.C6 ...
-
bioRxiv - Bioengineering 2020Quote: ... a p10 3’UTR fragment amplified from Addgene plasmid #100580 19 with primers 986.C3 and 986.C4 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746 ...
-
bioRxiv - Neuroscience 2023Quote: ... and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247). Ligation reactions were carried out by mixing 1 µL 10x NEB CutSmart buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... pGEX-4T-3-mR7BD (Addgene #79149, Edinger Lab). To generate Emerald-Rab7L8A ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3) AAV9-hSyn-ChR2(H134R)-eYFP (RRID:Addgene_127090 ...
-
bioRxiv - Molecular Biology 2024Quote: ... pN3-3×Flag-Control was purchased from Addgene (Watertown ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 3 μg of pCXWB-EBNA1 (Addgene #37624) were co-nucleofected into 1×106 primed hiPSCs using the Lonza 4D-nucleofector (“Primary Cell P3” solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target ROSA26 locus were subcloned into H2B-670 (modified from pmiRFP670-N1, #79987, Addgene) or FUCCI (kind gift from Ludovic Vallier’s lab ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target AAVS1 locus were subcloned into hOCT4 promoter containing phOCT4-EGFP plasmid (#38776, Addgene) using AAVS1 SA-2A-puro-pA donor plasmid (#22075 ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hcas9 (a gift from George Church; Addgene plasmid # 41815 ...
-
bioRxiv - Biochemistry 2020Quote: ... we used plasmids encoding hDicer 3’-pocket double mutant (Y926F, R927A), and the 5’-pocket sextuple mutant (R778A, R780A, R811A, H982A, R986A, R993A) (23) (Addgene). PCR fragments were subsequently cloned into the pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The AND gate constructs were optimized by making constructs with ribosome binding site library (5’-GAAAGANNNGANNNACTA-3’) in front of regulators in chemically competent Marionette Clo cells prepared from Addgene [40] ...
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Neuroscience 2024Quote: ... From 5’ to 3’ the constructs consist of a Tet-On doxycycline inducible promoter (a gift from David Root (Addgene plasmid # 41393 ...
-
bioRxiv - Genetics 2024Quote: HeLa CRISPRi cells were generated by lentiviral integration (∼3 to 5 MOI) using the dCas9-KRAB-blast plasmid (Addgene #89567), followed by single cell isolation ...
-
bioRxiv - Cell Biology 2020Quote: ... and transfected at 4-6 h with a plasmid encoding HA-Separase (pCS2+HA-hSeparase was a gift from Marc Kirschner, Addgene plasmid # 33018), Plk1TD expression was induced 8-10 h after shake off and cells were fixed at 28 h to analyze distancing or at 32 h (20 h of S phase arrest ...
-
bioRxiv - Cell Biology 2019Quote: ... BbsI digested fragment containing gRNA core and dU6:3 promoter was PCR amplified from pCFD4-U6:1_U6:3-tandemgRNAs (gift from Simon Bullock (Addgene plasmid # 49411) (Port et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Immunology 2024Quote: HEK293T cells were transfected with 3 µg of pmirGLO plasmid containing the 3’UTR of Zc3h12a or Tnf (Addgene plasmid 207127) (7 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...