Labshake search
Citations for Addgene :
351 - 400 of 1590 citations for 6 AMINO 3 HYDROXY PYRIDO 2 3 B PYRAZINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pPD118.33 (Pmyo-2∷GFP) (Addgene plasmid #1596) at 5 ng/μl and pBSKS (Stratagene ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR223 SARS-CoV-2 NSP2 (Addgene, 141256) and expression clones with N-terminal fusion tags were produced simply by Gateway cloning (Gateway™ LR Clonase™ II Enzyme mix ...
-
bioRxiv - Microbiology 2022Quote: ... pDONR207 SARS-CoV-2 NSP1 (Addgene, 141255), pDONR223 SARS-CoV-2 NSP2 (Addgene ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327 ...
-
bioRxiv - Cancer Biology 2019Quote: ... or into lentiCRISPR ver.2 (Addgene, #52961) using the BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: [2] GAL4d from pBPGAL4.1Uw (Addgene plasmid #26226)(Primers:ADdomain,forward,5’-caggcggccgccataTGCATGGATCCGCCAACTTC AACCAGAGTGG-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg pMDLg/pRRE (Addgene plasmid #12251), 4.64 µg pRSV-Rev (Addgene plasmid #12253) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... NKX6.1 in pX330S-2 (Plasmid #58778; Addgene), MAFA in pX330S-3 (Plasmid #58779 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pcDNA3.1-2xFLAG-SREBP-2 (#26807, Addgene). Amplified N-SREBP1a (Ad5-N-SREBP1a) ...
-
bioRxiv - Molecular Biology 2022Quote: ... For overexpressing ACE2 (Addgene, Appendix Table 2) in HPLFs ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and pBMTBX-2 (Addgene plasmid No. 26073) were gifts from Dr ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 NSP6 (Addgene #141260), and pDONR223 SARS-CoV-2 spike (Addgene #149329 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2 µg pMD2.G (#12259, Addgene) plasmids by using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR207 SARS-CoV-2 nsp3 (Addgene # 141257), pDONR223 SARS-CoV-2 NSP6 (Addgene #141260) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and psPAX2 (2 µg; Addgene, Cat# 12260) were co-transfected with lentiviral expression construct (3 µg ...
-
bioRxiv - Genomics 2023Quote: ... and pMDG.2 (envelope vector; Addgene #12259) with the TKOv3 lentiCRISPR plasmid library [59] ...
-
bioRxiv - Neuroscience 2023Quote: ... ipo13b sgRNA2 into pU6a:sgRNA#2 (Addgene #64246), and ipo13b sgRNA3 into pU6b:sgRNA#3 (Addgene #64247) ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Genetics 2024Quote: ... and β-arrestin 2-mYFP (Addgene #36917). FUZ-mCherry was generated by sub-cloning with XhoI/BamHI into mCherry2-N1 backbone vector (Addgene #54517) ...
-
bioRxiv - Genetics 2021Quote: ... the cassette containing the C terminus half of the DddAtox (split at 1397 amino acid position) and UGI was amplified from the DdCBE plasmid (Addgene plasmid no. 157844). The PCR amplicon was digested with XbaI and BsU36I restriction enzyme and cloned in the pkTol2c-FusXTBE-N vector linearized with XbaI and Bsu36I to generate pkTol2c-FusXTBE-C plasmid ...
-
bioRxiv - Immunology 2022Quote: ... The Vκ1-33/CBE replacement of Vκ3-2 was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and two guide RNAs that target the mouse Vκ3-2 segment ...
-
bioRxiv - Immunology 2019Quote: ... 2×106 HEK293T cells stably expressing FLAG-tagged Hem1 were transiently transfected with 2 μg myc-Rictor plasmid (Addgene). Control HEK293T cells were transfected with myc-Rictor or 10 ng GFP-3xFLAG as described ...
-
bioRxiv - Genomics 2019Quote: The plasmid pCMV-myc-Atg7(2) expressing ATG7 isoform 2 was a gift from Toren Finkel (Addgene plasmid #24921).31 The plasmid pCMV-myc-Atg7(1 ...
-
bioRxiv - Biophysics 2021Quote: ... The gp67-438-B modified from 438-B (Addgene) was used to express recombinant secretory proteins.
-
bioRxiv - Microbiology 2022Quote: ... pLenti-X2-Zeo-DEST (749-3) [a gift from Eric Campeau (Addgene, 21562)] and the donor vector ...
-
bioRxiv - Cell Biology 2019Quote: ... pCIG3 (pCMV-IRES-GFP version 3) was a gift from Felicia Goodrum (Addgene plasmid # 78264 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...