Labshake search
Citations for Addgene :
351 - 400 of 1824 citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... For Ca2+ imaging of mPFC layer 5 excitatory neurons 1 μl pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (Addgene) was injected bilaterally into mPFC of VGlut2-cre mice (+0.9 mm anterior-posterior ...
-
Structures of native SV2A reveal the binding mode for tetanus neurotoxin and anti-epileptic racetamsbioRxiv - Biochemistry 2024Quote: ... Nb1-5 were PCR amplified and subcloned into the vector pBXNPHM365 (Addgene #11099) and fused with a C-terminal (TSII-tagged ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml of pT3-EF1a MYC DNA (92046, Addgene, Watertown, MA, USA), and 0.5 µg/ml pCMV HSB2 sleeping beauty transponase was prepared in a sterile 0.9% sodium chloride (NaCl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Molecular Biology 2020Quote: The hCRIPSRi-v2 library top 5 sgRNAs/ gene (Horlbeck et al. 2016)(Addgene # 83969), was a gift from the Jonathan Weissman lab at UCSF ...
-
bioRxiv - Cell Biology 2022Quote: ... Enhanced GFP (EGFP) was PCR cloned from pLenti CMV GFP Puro (Addgene 658-5) with primers CTCGTCGACCATGGTGAGCAAGGG and CTCGGATCC CGTTACTTGTACAGCTCGT and cloned into hIL8-pCHD at the SalI and BamHI restriction sites.
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Cancer Biology 2024Quote: ... libraries with 5 sgRNAs per gene (mCRISPRi-v2; the “top5” library from Addgene #1000000092) or 10 sgRNAs per gene (hCRISPRi-v2 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 x 106 HEK293T cells were co-transfected with 5μg psPAX2 (Addgene, Plasmid # 12260), 5μg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1:5 AAV1-Ef1a-fDIO-tdTomato (128434-AAV1, Addgene, 1×10¹³ vg/mL) was made into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (gifted from Melina Fan [Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964]), pAAV2/7 (gifted from James M ...
-
bioRxiv - Immunology 2024Quote: ... Two BA.5 NTD DMS libraries were further assembled into pETcon 2649 vector (Addgene) and electroporated into electrocompetent DH10B cells for plasmid amplification ...
-
bioRxiv - Neuroscience 2024Quote: ... a backbone plasmid of pLV.PARP1#5 (a gift from Didier Trono - Addgene plasmid # 14548), to produce pLV.Usp14shRNA ...
-
bioRxiv - Biophysics 2024Quote: ... 5 μg of pMD2.G envelope plasmid (Addgene #12259, generated in Dr Trono’s lab) and 2.5 μg of pRSV-Rev plasmid (Addgene #12253 ...
-
bioRxiv - Cancer Biology 2024Quote: 10 µg of the expression plasmid and 5 µg pCL-Eco (Addgene plasmid #12371) were co- transfected into Pheonix-Eco cells in the culture medium without antibiotics ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Systems Biology 2022Quote: ... we prepared the vector backbone by incubating 5 ug of CROPseq-Guide-Puro (Addgene #86708) for 2 h at 37 °C with 2 ul of FastDigest Mph1103I (ThermoFisher cat ...
-
bioRxiv - Cancer Biology 2020Quote: pCFDg1-5 gRNA-tRNA array was constructed stepwise as previously described using pCFD5 (Addgene #73914)11 as a template and V8 targeting gRNAs.
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... into the HindIII/XbaI site 5’ of the Gateway cassette of pMpGWB401 (Addgene enry #68666). The reversely transcribed MpSUK1 locus (2.7kb ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected AAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 (5×1011 gc/mL; Addgene) bilaterally into the lateral hypothalamus of the previously characterized and validated MCH-Cre mice42 ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Bioengineering 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (RRID:Addgene_17448)[33] ...
-
bioRxiv - Neuroscience 2024Quote: Intracerebroventricular injections of 5 μL of either AAV9-hSyn-DIO-hM3Dq-mCherry (Addgene # 44361-AAV9) (90 ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.25 µL of EnvA G-Deleted Rabies-mCherry (diluted 1:5 in dPBS; Addgene: 32636) was injected in the basal forebrain using the same coordinates ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448 ...
-
bioRxiv - Neuroscience 2024Quote: ... while the Halo tag sequence was amplified from the TUBB-5 Halo plasmid (Addgene, #64691). These elements ...
-
bioRxiv - Microbiology 2024Quote: ... pLenti PGK GFP Puro (w509-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19070 ...
-
bioRxiv - Biochemistry 2024Quote: ... blasticidin (Sigma-Aldrich, 5 μg/mL for four days; pLenti CMV Blast – Addgene plasmid #17451), or hygromycin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Cell Biology 2021Quote: ... antisense: 5’-aaacTACGCATTGGACGGCTCCTCc) was cloned into pSpCas9 (BB)-2A-mCherry created by PX459 V2.0 (Addgene #62988). This plasmid was then transfected into immortalized STING-knockout MEFs (Mukai et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... SKOR1-shRes-WT and -Y234F were then recombined into pLenti CMV-GFP (658-5) (Addgene; 17448). For transduction of the above mentioned constructs ...
-
bioRxiv - Neuroscience 2022Quote: ... [14] and low-titer Cre (AAV9-hSyn-Cre-WPRE-hGH; Addgene #105553, MOI = 5×103 vg) AAVs on DIV 7 ...
-
bioRxiv - Cell Biology 2020Quote: ... Blunt-end repaired RhoBAST16 was cloned into 5′ UTR CGG 99× FMR1-EGFP (Addgene, plasmid #63091) which was digested with the NotI enzyme ...
-
bioRxiv - Molecular Biology 2021Quote: ... an XhoI restriction site was generated 5’ of the GFP-gene in pDRGFP (Addgene plasmid #26475)23 and the GFP-gene was replaced by the eBFP1.2 gene using the XhoI/NotI restriction sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... and guide cassettes were assembled into pGGG-M along with end linker pELE-5 (Addgene #48020). The resulting plasmid was named pGGG-TaDMC1-D and sequenced to ensure authenticity before transferring to Agrobacterium.
-
bioRxiv - Molecular Biology 2023Quote: ... Three clones with the correct insertion were transiently transfected with either 5 μg pFlpO (Addgene #13793) to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792 ...