Labshake search
Citations for Addgene :
351 - 400 of 2576 citations for 4S 6 8 difluoro 3 4 dihydro 2H 1 benzopyran 4 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: AAV2/8 hSyn-DIO-mCherry (Addgene, 2.5E13 GC/ml)
-
bioRxiv - Developmental Biology 2023Quote: ... pCS2+8 was a gift from Amro Hamdoun (Addgene plasmid #34931 ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Genomics 2021Quote: ... and pMD2.G (Addgene, 12259, 6 µg) using calcium phosphate precipitation (62) ...
-
bioRxiv - Pathology 2021Quote: ... and 6 μg pMD2.G (Addgene 12259) or pEC120-S-D19-V5 ...
-
Development of ketobenzothiazole-based peptidomimetic TMPRSS13 inhibitors with low nanomolar potencybioRxiv - Pharmacology and Toxicology 2024Quote: ... 6 μg helper plasmid (psPAX2, Addgene #12260), and 6 μg of SARS-CoV-2 Spike protein of the delta variant ...
-
bioRxiv - Cancer Biology 2024Quote: HEK293 cells were cultured in 6-well plates and then transfected with 4 μg of previously described plasmid vectors encoding ER stress reporter genes ATF4-mS (#115970, Addgene, Cambridge, MA, USA), XBP1-mN (#115971) ...
-
bioRxiv - Neuroscience 2024Quote: ... Gq DREADD virus (n=23, 12 males, 11 females: AAV8-hSyn-DIO-hM3Dq-mCherry, ≥ 4×101 2 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express excitatory designer receptors in VP GABA neurons ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cell Biology 2020Quote: ... GST-14-3-3 (Plasmid 1942) expression vectors were obtained from Addgene and described 45–46.
-
bioRxiv - Neuroscience 2021Quote: ... (3) AAV8-Syn-ChR2(H134R)-GFP (3×108 g.c.; Addgene #58880-AAV8), and (4 ...
-
bioRxiv - Biochemistry 2022Quote: ... The 3-nitro-tyrosine incorporation plasmid (pAcBac1-3-nitroTyr-A7, Addgene # 141173) was as previously described.35
-
bioRxiv - Physiology 2022Quote: ... Maternal hepatocyte-specific YAP1 deletion was achieved by injecting mice with the adeno-associated virus serotype 8 (AAV8) with the thyroxine-binding globulin promoter (TBG) promoter expressing Cre (AAV8-TBG-Cre virus, Addgene, AV-8-PV1091) via tail vein at a dose of 1×1012 genomic copies/mouse ...
-
bioRxiv - Neuroscience 2023Quote: ... 1.0 µL of diluted CaMKII.GCaMP6f (AAV1, diluted 1:3 with dPBS or AAV9, diluted 1:10 with dPBS, Addgene number: 100834) was injected in three locations throughout auditory cortex (1.5 mm from lambda ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Microbiology 2023Quote: 4e5 VeroE6 cells were plated in 6-well plates and transfected with 1 μg VSV-G plasmid (Addgene #8454) via TransIT-X2 (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Molecular Biology 2024Quote: ... LOX-1 tagged with V5-6×His at the C-terminus (V5-LOX-1) was subcloned into pmScarlet_C1 (plasmid #85042; Addgene) (mScarlet-LOX-1) ...
-
bioRxiv - Bioengineering 2024Quote: ... D-REPRESS 1 to 6 plasmids were cloned following the same manner with dRfxCas13d amplification from pXR002 (Addgene #109050)24 ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 (Addgene plasmid #96963)92 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg psPAX2 (Addgene), and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... the target sequence (5’-GGGTGAAGATCCTGTTCAATA-3’) was shuttled to the pLKO.1-Hygromycin vector (Addgene, #24150). For human astrocytes ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Cancer Biology 2020Quote: WM266-4 or SK-MEL-2 cells were co-transduced with conditioned media containing lentiviruses bearing Firefly luciferase-7TFP (Addgene #24308, β-catenin reporter) and Renilla luciferase pLenti.PGK.blast-Renilla Luciferase (Addgene #74444 ...
-
bioRxiv - Neuroscience 2024Quote: ... For optogentic activation of the glutamatergic PPN in Figure 3S: AAV5-Ef1a-DIO-hChR2-(E123T/T159C)-eYFP-WPRE was injected into the PPN (Addgene, 35509-AAV5, 4×10e12). For chemogenetic experiments in Figure 4 and 4S ...
-
bioRxiv - Immunology 2022Quote: ... a 3’ LTR-restored lentiviral expression vector (Addgene #101337, hereafter LV-3’LTR) expressing a GFP reporter was used to express ACE2 or CD169 ...
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV2/8-hSyn-DIO-eGFP were obtained from Addgene.
-
bioRxiv - Neuroscience 2021Quote: ... 15μg of pAAV2-8 Rep-Cap plasmid (Addgene plasmid # 112864), and 15μg of pAAV-EF1a-DIO-ChloPhensor ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Biochemistry 2024Quote: ... mCherry-EB1-8 was a gift from Michael Davidson (Addgene plasmid #55035 ...
-
bioRxiv - Biochemistry 2024Quote: ... were inserted into the pHLmMBP-8 vector (Addgene, cat # 72347)85 using restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: GFP tagged WT Keratin 8 in pEGFP-N3 (Addgene 6080) was kindly provided by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109, Addgene_183127, Addgene_65179, Addgene_183126, Addgene_110593, Addgene_110597), and dsRNA target sequence (Type 3 ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Cell Biology 2020Quote: ... and envelope (6 μg pMD2.G, Addgene #12259) viral plasmids were diluted in 500 μL serum-free DMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 6 μg of psPAX2 (Addgene, Cat #12260) into a 10 cm plate of HEK293T cells at 60-70% using Fugene 6 transfection reagent (Promega ...
-
bioRxiv - Cell Biology 2024Quote: ... the psPax2 packaging plasmid (6 µg, Addgene, #12260), the pMD2.G packaging plasmid (2 µg ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect pBABE-puro or pBABE-puro.SLX4IP.3xFLAG with pCMV-VSV-G (at a ratio of 6:1, Addgene#8454) into GP2-293 cells (Clontech) ...
-
bioRxiv - Bioengineering 2020Quote: ... 400,000 HEK cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 (Addgene #12260), 3 μg pCMV-VSV.G (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were transfected with a 6:1 ratio of a firefly luciferase reporter plasmid driven by a pGL3-RARE-responsive promoter (Addgene) and a Renilla luciferase reporter plasmid driven by a constitutive CMV promoter (Promega) ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 6 mice from each line were injected bilaterally with a pAAV9-CAG-Flex.GCaMP6s.WPRE.SV40 virus (Addgene, titre ≥ 1×1013 vg/mL) in the medial NAc shell (D1-cre and D2(A2a)-cre mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA) (Addgene) using standard methods (42) ...
-
bioRxiv - Bioengineering 2024Quote: ... the kanamycin-resistance gene AphAI flanked by an I-SceI restriction site (I-SceI-AphAI fragment) was amplified using primers 5 and 6 listed in Supplementary Table 1 from pEPkan-S (Addgene plasmid #41017 ...