Labshake search
Citations for Addgene :
351 - 400 of 1146 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Molecular Biology 2022Quote: Synthesized IRIS guide RNA oligonucleotide (target sequence: 5’-CTGGGGCAAACACAAAAACCTGG-3’) was cloned into the BsmB1 sites of the lentiCRISPRv2 vector (a gift from Feng Zhang, Addgene plasmid #52961)50 following the protocol described by Sanjana et al.50 ...
-
bioRxiv - Microbiology 2024Quote: ... sequence targeting the third exon of the human L1CAM gene (5’-GAGTAGCCGATAGTGACCTG-3’) was designed and cloned into the pKLV2-U6gRNA(BbsI)-PGKpuro2ABFP vector (Addgene plasmid #67974). For the production of lentiviral particles carrying the CRISPR/Cas9 components ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an sgRNA against PTEN (sgPTEN: 5’-GAC TGG GAA TAG TTA CTC CC -3’) in the LCV2-hygro backbone (Addgene Plasmid #98291), or infected with the pHRIG-AKT1 lentiviral construct (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR donor plasmids were cloned with 0.8 kb 5’ and 3’ homology arms amplified from fly genomic DNA into pUC57(Addgene plasmid #51019, RRID:Addgene_51019), flanking the different CTail Shot-eGFP coding sequences ...
-
bioRxiv - Genetics 2024Quote: ... carrying an sgRNA (5’-AAGGAAACTAAGACGTGCGA-3’) and two plasmids carrying mAID-mClover flanked by XPG sequences and a neomycin casette (pMK289, Addgene plasmid #72827) or a hygromycin cassette (pMK290 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg D8.9 and 3 µg pCMV-VSV-G (Addgene) packaging plasmids using Lipofectamine LTX with Plus Reagent (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Genetics 2024Quote: ... with the dU6:3 promoter from pCFD3 (Addgene #49410, [19]). A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mito-mCh-1×FLAG and Mito-mCh-smFLAG were constructed by ligating 1×FLAG synthesized by overlapping PCR and smFLAG amplified from smFLAG-KDM5B-24×MS2 (Addgene # 81084) with previously built Mito-mCh-1×HA cut by BglII and BamHI through Gibson Assembly.
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells seeded on 35mm MatTek chambers with 70% confluency were loaded with 1 µg of smFLAG-KDM5B-24×MS2 (Addgene #81084), 0.5 µg of anti-FLAG FB-GFP and 130 ng of purified MCP-HaloTag protein by bead loading (Cialek et al. ...
-
bioRxiv - Genetics 2022Quote: ... Flox cells were grown in 24-well plates for 24h and then transfected with 130ng of H2B-GFP plasmid (Addgene, 11680). After 5h ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were plated in 24-well plates and transfected with YAP/TAZ luciferase reporter 8XGTIIC-lux plasmid (50 ng/cm2) (Addgene 34615) together with CMV-lacZ (75 ng/cm2 ...
-
bioRxiv - Neuroscience 2021Quote: ... or by the Canadian Neurophotonics Platform Viral Vector Core Facility (RRID:SCR_016477) (Quebec - Canada) using the ad hoc capside plasmid (pUCmini-iCAP-PHP.S, a gifts from Viviana Gradinaru; Addgene plasmid # 103006; 24). Control rAAV PHPs CAG mCherry was bought from Addgene (viral prep # 59462-PHP.S)
-
bioRxiv - Genomics 2023Quote: ... 4M cells were plated in a 10cm dish for 24-hours before transfecting HEK293T cells with 9ug of dCas9-mCherry-KRAB (Addgene #60954), 4ug of packing plasmids psPAX.2 and 2ug of the envelope vector pMD2.G diluted in OptiMEM medium and Trans-Ltl transfection reagent (Mirus) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... gene cat was inserted randomly in the staging plasmid as described in Nadler et al.24 using the following plasmids with some modifications: pUCKanR-MuA-BsaI (Addgene #79769), pATT-Dest (Addgene #79770) ...
-
bioRxiv - Genetics 2023Quote: We plated 550,000 HEK293T cells on 6-well plates and 24 hours later we transfected the cells with 900 ng psPAX2 packaging vector (Addgene #12260), 360 ng pMD2.g VSV-G envelope vector (Addgene #12259) ...
-
bioRxiv - Microbiology 2022Quote: ... in DMEM+10% FBS supplemented with 20 μg/ml G418 to select for transduced cells.Selection was repeated for 6 passages and selected cells were expanded into 24 well plates and transfected with pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230; Addgene, Watertown, MA) by Trans IT LT-1 (Mirus Bio ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 × 106 cells were plated in 60 mm dishes for 24 hours followed by transfection with m6A-Tracer GFP (AddGene, 139403) and DAM-lamin B1 (AddGene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB) (Addgene plasmid #163115). Site saturation mutagenesis was carried out according to a previous protocol (Liu & Naismith ...
-
bioRxiv - Neuroscience 2023Quote: ... Tet-O-NFIB-hygro (Addgene plasmid #117271), and FUdeltaGW-rtTA (Addgene plasmid #19780) ...
-
bioRxiv - Neuroscience 2024Quote: ... encoding pTet-O-Ngn2-puro (Addgene #52047) and FUΔGW-rtTa (Addgene #19780) ...
-
bioRxiv - Neuroscience 2024Quote: ... Tet-O-NFIB-hygro (Addgene plasmid #117271), and FUdeltaGW-rtTA (Addgene plasmid #19780) ...
-
bioRxiv - Neuroscience 2020Quote: ... rv 5’-ATTTTAACTTGC-TATTTCTAGCTCTAAAACAACCATGTTCCG-TATTCAGATGCACCAGCCGGGAATCGAACC-3’) that were cloned with a single Gibson Assembly reaction in a pCFD6 (Addgene plasmid # 73915; RRID: Addgene_73915) vector [27] which was previously digested with BbsI restriction enzyme.
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Cell Biology 2024Quote: Suitable gRNA target sites (5 ′ gRNA: GGAGGCTCTCGTGCCGGCTC, 3 ′ gRNA: GCTATAGGAAGCCACCGTTA) were identified by CRISPR optimal target finder 45 and cloned into pCFD5 (Addgene plasmid #73914; 46) via Gibson assembly (NEB).
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All WCFS1 transformations were done via electroporation following a previously documented protocol.24 WCFS1 was first transformed with helper plasmid pLH01 (Addgene Plasmid #117261) containing phase recombinases under an inducible promoter ...
-
bioRxiv - Neuroscience 2024Quote: Neurons were isolated by first virally labeling neurons from the same batch with pAAV-CAG-tdTomato for 24 hours (1:50 dilution, Addgene 59462-AAV1) prior to incorporation into miBrain or monoculture ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Immunology 2020Quote: ... devil NLRC5 was amplified from pAF105 with overlapping ends to the 5’ and 3’ SfiI sites of the Sleeping Beauty transposon plasmid pSBbi-BH42 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) using Q5® Hotstart High-Fidelity 2X Master Mix (New England Biolabs (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...