Labshake search
Citations for Addgene :
351 - 400 of 1731 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μg psPAX2 (Addgene plasmid #12260) in 50 μL Opt-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μg packaging plasmid (Addgene #12260). 24 hours post transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... DR8.2 (1 µg) packaging construct (Addgene #8455) and the PMD2.G (5 μg ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cell Biology 2023Quote: ... and KIF5C(1-560)-mCit (Addgene #61676) were a gift from Kristen Verhey92 ...
-
bioRxiv - Microbiology 2023Quote: ... 1/10th mass BirA (Addgene plasmid 20857), and 50 µM D-biotin at 30 °C for 1 h ...
-
bioRxiv - Cell Biology 2023Quote: ... pLVX-FLAG-dTomato-centrin-1 (Addgene,#73332), pLentiPGK DEST H2B-iRFP670 (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... and empty pKLO.1-hygro (Addgene, 24150) were used as negative controls.
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G (1 µg; Addgene, Cat# 12259) and psPAX2 (2 µg ...
-
bioRxiv - Cancer Biology 2023Quote: ... LV-Cre pLKO.1 (Addgene plasmid 25997), which encodes Cre-recombinase in the backbone of the pLKO.1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... and inserted into pLKO.1 Vector (Addgene). To package the third generation lentiviral vectors ...
-
bioRxiv - Immunology 2023Quote: ... pLenti CMV rtTA3 Blast (Addgene w756-1) stably expressing clonal RAW MΦs were transduced with pLenti CMV Puro DEST (Addgene w118-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Developmental Biology 2024Quote: ... and peroximal targeting signal 1 (Addgene, 54520) were cloned into mCherry-bearing pcDNA6 (Golgi-mCherry and PEX-mCherry) ...
-
bioRxiv - Neuroscience 2024Quote: ... or pLKO.1-TRC-control (Addgene_#10879) (Moffat et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... vector backbone carrying spCas9 cDNA from Addgene #48138 and mCat-1 cDNA from Addgene #17224 (see Note 1).
-
bioRxiv - Neuroscience 2024Quote: ... AAV-2/1/CAG-Flex-EGFP (Addgene), pENN.AAV.hsyn.Cre.WPRE.hGH (AAV1 ...
-
bioRxiv - Neuroscience 2024Quote: ... HIV-1 Rev (pRSV-Rev Addgene: 12253), and VSV g-glycoprotein Env (pMD2.G Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of pMD2.G (AddGene, #12259), and 1.5 μg of psPAX2 (AddGene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9.hSyn.GRAB_DA2h (1 x 1013GC/mL, Addgene) was used to detect dopamine (Sun et al. ...
-
bioRxiv - Immunology 2024Quote: ... 1 μg of pMDLg/pRRE (Addgene #12251), and 1 μg of pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... We used plasmid 1 (Addgene #176640 (21)) as the base plasmid for Library 1 ...
-
bioRxiv - Genetics 2024Quote: ... and 1 µg of Flippase (Addgene 1379382) recombinases were transfected ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pLKO.1-TRC cloning vector (Addgene), psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... Vector PLKO.1 Neo (shCtrl; Addgene, 13425) and Egfp open reading frame (Egfp OE ...
-
bioRxiv - Cell Biology 2024Quote: ... and pLKO.1-shDrp1-GFP (RRID: Addgene_228737).
-
bioRxiv - Cancer Biology 2020Quote: ... pLenti CMV rtTA3 Blast (w756-1) and pLenti CMVTRE3G eGFP Neo (w821-1) were gifts from Eric Campeau (Addgene plasmids #26429 and #27569 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentiviral particles of shZDHHC5 (target sequence 5’CCCAGTTACTAACTACGGAAA3’ in pLKO.1 vector) and empty pLKO.1 (Addgene, 8453) were packaged in HEK293T cells and used to transduce PCDH7-GFP-BAC cells ...
-
bioRxiv - Molecular Biology 2020Quote: ... NSUN6 knockdown mediated by shRNA was performed using pLKO.1-blast plasmid (modified from pLKO.1-puro, #10878, Addgene) with following shRNAs ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Genomics 2024Quote: ... the 1 μg of total DNA was split in a 1:15 ratio of pCAG-NLS-Bxb1 (Addgene #51271) and recombination vector ...
-
bioRxiv - Cancer Biology 2024Quote: Viral particles were packaged in HEK293T cells by transfecting the pLKO.1-shCYB561 constructs or scrambled shRNA pLKO.1 (RRID:Addgene_1864) (30 ...
-
bioRxiv - Microbiology 2023Quote: ... pLentiCMVPuroDEST (w118-1) and pLentiCMVHygroDEST (w117-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17452 and #17454) [33] ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were injected with a target transgene (50 ng μl-1) with plasmid pJL43.1 (50 ng μl-1) (Addgene) that expresses MosTase under a germline promoter and plasmid pMR910 (20 ng μl-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or a 1:1 combination of GCaMP6f+hM4Di-mCherry (same as used for behavior, AAV8-CaMKIIa-hM4Di-mCherry, Addgene).
-
bioRxiv - Neuroscience 2024Quote: ... using a Hamilton Neuros syringe filled with a viral cocktail mixture (1:1) of AAV8 HSyn-Con/Fon-YFP (2.4e13 vg/mL, Addgene) and AAV8 Ef1a-Coff/Fon-mCherry (2.2e13 vg/mL ...
-
bioRxiv - Immunology 2024Quote: hPD-1 retroviral plasmid was generated by inserting hPD-1 cDNA into MSCV-IRES-Thy1.1 DEST (Addgene, catalog# 17442). Point mutations were introduced by using QuikChange ll site-directed mutagenesis kit (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... pLKO.1 puro CXCR4 siRNA-1 and siRNA-2 were gifts from Bob Weinberg (Addgene plasmids #12271 and #12272). plKO.1 scramble shRNA was a gift from David Sabatini (Addgene plasmid #1864) ...
-
bioRxiv - Microbiology 2022Quote: ... All shRNAs were generated by cloning shRNA hairpin sequences found in Table 3 into pLKO.1-TRC Puro (pLKO.1-TRC cloning vector was a gift from David Root (Addgene plasmid # 10878 ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pLenti CMV rtTA3 Hygro (w785-1) used for creating tetracycline-inducible cell lines were gifts from Eric Campeau (w762-1: Addgene plasmid #26434 ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Cancer Biology 2021Quote: ... For loss of function studies, pLKO.1 puro and pLKO.1 shCDH1 (Onder et al., 2008) were purchased from Addgene. pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120 ...
-
bioRxiv - Cell Biology 2022Quote: ... gBlock 1 encoding N-terminus Calponin domains (CH-CH) of giant Nesprin 1 was cloned into Spectrin-cpstFRET (plasmid#61109, Addgene) cut with AgeI and ScaI renstriction enzymes (New England Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Microbiology 2020Quote: ... pmTurquiose2-Golgi (Beta-1,4-galactosyltransferase 1 1-61 Aa) in red is to show the Golgi apparatus (Addgene cat 36205) (27) ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...