Labshake search
Citations for Addgene :
301 - 350 of 961 citations for rno mir 137 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We used DNA parts provided with the EMMA cloning kit (Addgene kit # 1000000119) and generated DNA fragments by PCR using Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2021Quote: ... pCR-U6-gRNA-miniCMV-TdTomato was generated by inserting miniCMV-TdTomato from reporter-gT1 (Addgene plasmid #47320 ...
-
bioRxiv - Developmental Biology 2021Quote: ... to insert PCR-amplified genomic regions into the VanGlow vector with the DSCP (Addgene#83338). The various transgenic reporters were integrated into the VK31 site on chromosome 3 using φC31-mediated integration (Bischof and Basler ...
-
bioRxiv - Neuroscience 2021Quote: ... TOPO-cloned the PCR products into pENTR-D-TOPO and transferred to pBPGUw (Addgene #17575) using standard Gateway cloning ...
-
bioRxiv - Neuroscience 2019Quote: ... We used PCR to amplify GFP from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (JFRC, Addgene) and added an AgeI site to the reverse primer ...
-
bioRxiv - Biochemistry 2019Quote: ... Entry clones were produced by PCR amplification of portions of the NF1 gene from Addgene construct 70423 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR of mNG-GECO variants were ligated into Tol2-HuC-H2B vector (Addgene plasmid #59530) cut with SalI/AgeI using Gibson Assembly ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the T7RNAPK276R sequence was PCR amplified from plasmid pRS315-nls-T7-RNAP (Addgene plasmid #33152) (30 ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 4) were used for PCR and inserted into pCFD5 (Addgene #73914) via Gibson Assembly ...
-
bioRxiv - Microbiology 2019Quote: ... The native dcas9 and transcriptional terminators were PCR amplified from pdCas9-bacteria (Addgene plasmid # 44249) with Q5 polymerase (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... the human TSC1 gene was PCR amplified from a vector containing the hTSC1 cDNA (Addgene) 70 ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR products were then inserted in the pJFRC4-3XUAS-IVS-mCD8::GFP (Addgene 28243) linearized by NotI ...
-
bioRxiv - Microbiology 2021Quote: ... constructed via overlap extension PCR and integrated into the vector designed by [37] (Addgene #73224), which inserts into the slr0230 site of the Synechocystis genome ...
-
bioRxiv - Cancer Biology 2020Quote: ... full length DVL2 and DVL3 PCR-fragments were amplified from 3X-FLAG-DVL2 (Addgene #24802) and XE251-pcDNA3.1 (zeo ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet was amplified by PCR from pmScarlet_alphaTubulin_C1 a gift from Dorus Gadella (Addgene plasmid #85045) (74) ...
-
bioRxiv - Plant Biology 2022Quote: ... The evolved TadA8e (Richter et al., 2020b) was PCR amplified using the ABE8e plasmid (Addgene) as template and primers ABE8-F1/R1 ...
-
bioRxiv - Cell Biology 2022Quote: ... of two PCR based fragments generated by amplifying the pN-PITCh-GFP (Addgene plasmid #127888) vector backbone using primers 5’ caaacacgtacgcgtacgatgctctagaatg and 5’ tgctatgtaacgcggaactccatatatggg and the Rac1 sequence flanked Puro-GFP cassette from pN-PITCh-GFP using primers 5’ccgcgttacatagcatcgtacgcgtacgtgtttggGGCCCAGCGAGCGGCCCTGAtgaccgagtacaagcccacg and 5’cattctagagcatcgtacgcgtacgtgtttgggACCACACACTTGATGGCCTGCAtcttgtacagctcgtccatgccgag.
-
bioRxiv - Biochemistry 2022Quote: ... plasmids (Strecker et al., 2019) used in droplet digital PCR experiments were sourced from Addgene. The PSP1-targeting spacer was cloned into pHelper by Gibson assembly ...
-
bioRxiv - Neuroscience 2020Quote: ... Modified TALE constructs were created using PCR fragments amplified from pAAV-CW3SL-EGFP (Addgene # 61463), a gift from Bong-Kiun Kaang (Choi et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... mAID-mCherry was first amplified by PCR from pMK292 mAID-mCherry2-NeoR plasmid (Addgene #72830) using primers 5’- AATTGGTACCGGATCCGGTGCAGGCGCCAAG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse PGC-1α FL and ΔCTD were PCR-amplified from the pcDNA-f:PGC1 (Addgene, # 1026) and pcDNA-f:PGC1(delta CTD ...
-
bioRxiv - Neuroscience 2021Quote: ... mCherry was PCR amplified from u-mCherry (a gift from Scott Gradia; Addgene plasmid # 29769). The polylinker sequences between ion channels and mCherry are GGSGGGSGGSGS for eSlack1/ eSlick ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... oligonucleotide pairs (Table S8) were used for PCR and inserted into pCFD5 (Addgene no. 73914) via Gibson Assembly ...
-
bioRxiv - Cancer Biology 2021Quote: ... The PCR products were cloned into the BsmBI-digested lentiviral vector LRG2.1 (Addgene plasmid # 108098) using a Gibson Assembly® Cloning Kit (New England BioLabs ...
-
bioRxiv - Cell Biology 2020Quote: ... the TurboID fragment was amplified by PCR from the 3xHA-TurboID-NLS_pCDNA3 plasmid (Addgene #107171) with primers 8 and 9 ...
-
bioRxiv - Genetics 2019Quote: ... The GFP sequence was amplified by PCR from plasmid pBI-MCS-EGFP (Addgene plasmid #16542)19 and all fragments were Gibson assembled to provide the sgRNA-dCas9-VP160-2A-GFP vector ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the Streptococcus Pyogenes dCas9GCN4 was PCR amplified from the PlatTET-gRNA2 plasmid 37 (Addgene #82559), and sub-cloned under the control of a DOX-inducible TRE-3G promoter into a PiggyBac backbone ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with one gypsy insulator element (KpnI digest, PCR with 1157A_onestep_for and 1157A_onestep_rev) and subsequently PRE-Hsp70BbCas9_1.3 (Addgene 190797) with two gypsy insulator elements (AfeI digest ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR products were subsequently cloned pExpTol2-UAS-E1B-ReaChR-TS-tagRFP-cryaa-mCherry (Addgene #43963) digested with SpeI and PacI using Hi-Fi DNA Assembly.
-
bioRxiv - Cell Biology 2023Quote: PCR products from plasmids GFP-AHPH-WT (a gift from Michael Glotzer, Addgene plasmid # 68026) and GFP-AHPH-DM (a gift from Alpha Yap ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An EGFP coding sequence was first amplified by PCR from pLV-CS-112 (Addgene #131127) using the semi-random oligo pool SI#679 as a forward primer and another oligo pool RS#244 as a reverse primer ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Cancer Biology 2023Quote: The full length of IRX4_PEP1 was PCR amplified and cloned into the pDONR223 vector (Addgene) with the DYKDDDDK Flag tag by the BP recombination reaction protocol (Gateway® technology ...
-
bioRxiv - Biophysics 2023Quote: ... a linear DNA fragment was first amplified by PCR from plasmid pCDW114 (16, Addgene #70061), using primers 5′-GAAGGTCTCCAGCCGTACCAACCAGCGGCTTATC-3′ and 5′-CCGGG TCTCACCATACCCGCTGTCTGAGATTACG-3′ ...
-
bioRxiv - Biochemistry 2023Quote: ... CryC was constructed by inserting PCR amplified spTC (Addgene plasmid #153003, (Cho et al., 2020a)) onto restriction-digested Cry2-mCherry (Addgene plasmid # 26871 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1_eGFP was generated by PCR amplifying the eGFP CDS from Arch(D95H)-eGFP (Addgene #51081) and inserting into pcDNA3.1(-)/myc-His A using the EcoRI and NotI restriction sites ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pcDNA3.1-GPR91 was generated by PCR amplifying the GPR91 CDS from SUCNR1-Tango (Addgene #66507) (introducing a stop codon ...
-
bioRxiv - Biophysics 2023Quote: ... The baculovirus transfer vector pFastBac HT was PCR-amplified from pFastBac HT JS-Munc18b (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... the Cas13d-NLS cassette was PCR-amplified from the pXR001_EF1a-CasRx-2A-EGFP (Addgene #109049) plasmid and cloned into pLX_TRC311-NLS-Cas13b-NES-P2A-Blast-eGFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA fragment encoding APEX2 was PCR amplified from pcDNA5/FRT/TO APEX2-GFP (Addgene) and fused to the N-terminus of DDX3X using fusion PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Cell Biology 2023Quote: ... using 5 ng of PCR product and 50 ng of the CROPseq backbone (Addgene, 86708). PCR cycling parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... mEGFP was amplified using PCR and cloned into pLgw V5-EcoDam lentiviral constructs (Addgene; 59210) using SLIC ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR products were cloned into the doxycycline-inducible plasmid pCW57-MCS1-2A-MCS2 (Addgene #71782), which was modified by adding bGHpolyA between the MluI and BamHI restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... the M13-encoding sequence was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated between the ER-membrane targeting sequence and the NFAST-encoding sequence in the above described ER-NFAST plasmid ...