Labshake search
Citations for Addgene :
301 - 350 of 2448 citations for T cell leukemia lymphoma protein 1B TCL1B Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: The plasmid for membrane scaffold protein was MSP1D1 in pET28a was purchased from Addgene and prepared as previously described (Hagn et al. ...
-
bioRxiv - Immunology 2020Quote: ... and VSV-G protein-encoding plasmid pMD2.G were obtained from Addgene (Watertown, MA).
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Both fluorescent proteins originated from the plasmid pcDNA3.1(+)-NES-ZapCV2 (cpV143) (Addgene Plasmid #36231). Three variants of the parent DhdR-based FRET sensor were generated by removing the full-length DhdR domain and inserting PCR amplified truncated versions of DhdR in its place ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The dsRNA for Green fluorescent protein (GFP) was synthesised from plasmid pAC5.1B-EGFP (Addgene 21181) to be used as a negative control for off-target effects of dsRNA-mediated knockdown.
-
bioRxiv - Developmental Biology 2024Quote: ... we utilized monomeric enhanced green fluorescent protein (mEGFP) (gift from Karel Svoboda, Addgene plasmid #18696) (Harvey ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biochemistry 2024Quote: ... The tag-free wildtype (Wuhan-hu-1) nucleocapsid protein plasmid was purchased from Addgene (#177937), and the plasmid encoding the Strep-tagged nucleocapsid protein was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... We purchased the plasmid expressing an ER-localized hook protein from Addgene (Ii-Str_Neomycin; #65308). To generate various model substates with artificial CAT-tails ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-chain antibodies fused to GFP (scAB-GFP, Addgene #104998) were used for imaging translation sites through nascent polypeptide labeling ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cell Biology 2020Quote: ... The cDNA encoding EGFP-LC3 fusion protein was released from pBABE-EGFP-LC3-puro (Addgene, #22405) and cloned into pQCXIN-EGFP-N1-Neo by the 5’-EcoRI and 3’-AgeI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Genomics 2022Quote: ... Protein A-MNase was expressed and purified from BL21(DE) carrying pET-pA-MN (Addgene: 86973).68–70
-
bioRxiv - Cancer Biology 2024Quote: ... containing a C-terminus EGFP-tagged sequence of the full-length M237I p53 protein (Addgene, #11770), and 4 µL of Lipofectamine 2000 reagent ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cell Biology 2023Quote: ... conjugated with the Rhotekin Rho Binding domain (RBD)-GST fusion protein (produced from Addgene plasmid #15247), for 1 hour at 4 °C ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... All clones for lentiviral vectors expressing the proteins described in this study are available from Addgene.
-
bioRxiv - Bioengineering 2023Quote: ... the protein coding sequence (CDS) of RLuc8.6 was amplified from pcDNA-RLuc8.6-53559 (Addgene ID 87125) and subcloned into the vector pRSETb115 (Addgene ID 89536 ...
-
bioRxiv - Bioengineering 2024Quote: ... The mCherry red fluorescent protein was taken from the pU6-pegRNA-GG-acceptor plasmid (Addgene #132777) via PCR using Q5 High-Fidelity DNA Polymerase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: ... with the exception that a 1872 bp region of pLifeAct_mScarlet-i_N1 (Bindels et al., 2017) (26.4 kDa LifeAct-mScarlet protein, Addgene) encompassing the CMV enhancer element ...