Labshake search
Citations for Addgene :
301 - 350 of 1570 citations for Human Protein N terminal asparagine amidohydrolase NTAN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... HR2 was amplified from Col-0 (Fw: GGCTTAAUATGCCTCTTACCGAGATTATCG, Rv: AACCCGAUTTCAAAACGAAGCGAATTC) and mNeon c-terminal tag was amplified from pICSL50015 (Addgene: 50318) (Fw ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... Monobody HA4 or OptoMB variants were PCR amplified and Gibson-assembled from bacterial plasmids (described above) into a pHR vector with a C-terminal irFP fusion (Addgene #111510). The SH2 domain was amplified from EZ-L664 using PCR ...
-
bioRxiv - Cell Biology 2021Quote: ... codon optimized coding sequences with a C-terminal HA epitope tag were synthesized by IDT and cloned into a pCW57.1 (Addgene plasmid #41393) derived lentiviral vector with a blasticidin resistance gene (replacing the original puromycin resistance gene) ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the FRET-aggregation reporters were generated by subcloning full length human α-synuclein PCR-amplified from pCAGGS-aSyn-CFP (a gift from Robert Edwards and Ken Nakamura)39 to the C-terminal Clover2 or mRuby2 into the lentiviral expression vector pMK1200 (Addgene #84219)21 under the control of the constitutive EF1A promoter ...
-
bioRxiv - Cancer Biology 2021Quote: Previously described pMIG-Aalpha WT retroviral vector with a Flag-tag at the NH2 terminal (32) obtained from Addgene (plasmid #10884) was generously provided by William Hahn ...
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19) and cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138436). Mutations of the RLLLG motif in UL87 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Full-length mu24 was PCR amplified from MHV68-infected 3T3 cell cDNA with primers to introduce BamHI and NotI sites and cloned into pcDNA4/TO-2xStrep (C-terminal tag) using T4 DNA ligase (Addgene #138435). Full-length BcRF1 was PCR amplified from pcDNA4/TO-BcRF1-3xFLAG (19 ...
-
bioRxiv - Synthetic Biology 2019Quote: A plasmid for SpCas9 expression (2x NLS and C-terminal His tag, pET-28a) was a gift from the Gao group (Addgene #98158).50 E ...
-
bioRxiv - Synthetic Biology 2020Quote: The Sav library was created based on a previously described expression plasmid that contains a T7-tagged Sav gene with an N-terminal ompA signal peptide for export to the periplasm under control of the T7 promoter in a pET30b vector (Addgene #138589)34 ...
-
bioRxiv - Developmental Biology 2019Quote: Four gRNAs targeting loci on both sides of the C-terminal region of Rok containing the putative phosphorylation sites to be mutated were cloned into pCFD3 vector (Addgene 49410) following the protocol from (Port et al. ...
-
bioRxiv - Genetics 2023Quote: ... and assembled as a c-terminal FRB fusion gene and replacing the spCas9-mSA cassette of the PCS2+ Cas9-mSA plasmid (Addgene 103882) (Gu et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The codon optimized AOX with a C-terminal HA tag synthesized by IDT was cloned into pLv-EF1a-IRES-puro (Addgene 85132), pAAV.TBG.PI.eGFP.WPRE.bGH (Addgene 105535) ...
-
bioRxiv - Genetics 2023Quote: ... inverse PCR was used to first delete PGK-PuroR and create a linearized vector with terminal ends sharing homology with EF1α-BSD amplified from lentiCas9-Blast vector (Addgene 52962). In vivo assembly (IVA ...
-
bioRxiv - Biophysics 2023Quote: ... UblBilA was cloned into a vector encoding a C-terminal GFP tag (UC Berkeley Macrolab vector H6-msfGFP, Addgene ID 29725) and purified as above ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-amplified sequences of mouse Prdm1 and Prdm14 enhancers 11 bearing terminal NotI restriction sites were cloned into PCR4-Shh::lacZ-H11 (Addgene, # 139098). Plasmid clones were validated by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2024Quote: ... sgRNA oligos targeting the C-terminal region of target genes were cloned into the pX330 Cas9/sgRNA expression plasmid (Addgene 42230). For generation of the reporter line ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Molecular Biology 2020Quote: ... and UL87 were PCR amplified from these plasmids and cloned into BamHI/XhoI-cut pcDNA4/TO-2xStrep (C-terminal tag) using InFusion cloning (Addgene #138441-138452). Chimeras of the minimal domain (NTD ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... ORF66 was subcloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) to generate pcDNA4/TO-ORF66-2xStrep (Addgene plasmid #130953). ORF66 aa 1-200 was cloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag ...
-
bioRxiv - Molecular Biology 2019Quote: ... and ORF66 aa 200-429 was cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag) to generate pcDNA4/TO-ORF66 200-429-2xStrep (Addgene plasmid #130955). Point mutations in pcDNA4/TO-ORF66-2xStrep (Addgene plasmids #131109-131121 ...
-
bioRxiv - Cell Biology 2020Quote: ... Human ASK3 cDNA was also subcloned into pcDNA3 with a C-terminal tdTomato-tag (cDNA was gifted by M. Davidson, Florida State University, via Addgene: plasmid #54653) or pcDNA4/TO with an N-terminal Venus- or EGFP-FLAG-tag ...
-
bioRxiv - Molecular Biology 2021Quote: ... TDP-43 bacterial expression vector harboring a C-terminal MBP tag (pJ4M TDP-43-TEV-MBP-6xHis) was purchased from Addgene (Plasmid # 104480). TDP-43 mutations were generated by site-directed mutagenesis using QuikChange (Agilent ...
-
bioRxiv - Genetics 2020Quote: ... as a gene block with a C-terminal HA tag and cloned into pMSCV PIG (Puro IRES GFP empty vector) - a gift from David Bartel (Addgene plasmid # 21654). Retroviruses were generated using the retroPack system (Takara ...
-
Rhes protein transits from neuron to neuron and facilitates mutant huntingtin spreading in the brainbioRxiv - Neuroscience 2021Quote: ... pEGFP-N-Drd1 plasmid was a gift from Kirk Mykytyn (Addgene, 104358), GFP-DRD2 plasmid was a gift from Jean-Michel Arrang (Addgene ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry-SiT-N-15 plasmid was a gift from Michael Davidson (Addgene plasmid # 55133 ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521 ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting PCR product was inserted into pLVpuro-CMV-N-EGFP (Addgene plasmid # 122848 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sham animals included virgins injected with halorhodopsin (AAV1.CaMKIIa.eNpHR.EYFP; Addgene; N=1) that received no optical stimulation ...
-
bioRxiv - Cell Biology 2019Quote: ... and mEmerald-IFT88-N-18 was a gift from Michael Davidson (Addgene plasmid # 54125 ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Neuroscience 2019Quote: ... an eGFP-only reporter without DREADDs (n=7; Addgene: AAV2-hSyn-eGFP), was employed in a group of control rats [65–67].
-
bioRxiv - Cancer Biology 2021Quote: ... and pcDNA3-RLUC-POLIRES-FLUC (a gift from N. Sonenberg; Addgene #45642) (Poulin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... pCAG-VSV-N (#64087) and pCAGGS-T7Opt (#65974) were ordered from Addgene. S expressing pCAGGS vectors were used for the production of pseudoviruses ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Cancer Biology 2022Quote: ... FRA1 sequence from p6599 MSCV-IP N-HAonly FOSL1 vector (Addgene, 34897) was cloned into pLV-EF1α-IRES-puro vector (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV8-hSyn-DIO-GFP (Addgene, n=8, 4 male, 4 female) were injected bilaterally into the BNST (5 × 1012 titer ...
-
bioRxiv - Molecular Biology 2024Quote: ... the SMARCAL1 coding sequence was cloned into pLEX_305-N-dTAG (Addgene #91797) by the Gateway system (Life Technologies/Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... plasmid pKAN-PCUP1-9myc-AID*(N) from Addgene (Morawska and Ulrich, 2013), and plasmid pGIK43 from Georgios Karras.
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...