Labshake search
Citations for Addgene :
301 - 350 of 875 citations for 7 Oxabicyclo 4.1.0 hept 3 ene 3 carboxylicacid methylester 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene ...
-
bioRxiv - Immunology 2020Quote: ... Guide sequences (listed in Supplementary Table 3) were cloned into the lentiCRISPR v2 plasmid (Addgene #52961) and lentiviral particles were generated in 293T cells (ATCC ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746; http://n2t.net/addgene:107746; RRID:Addgene 107746) [32] ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Neuroscience 2019Quote: ... oligonucleotide pairs (Supplementary Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410), as described59 ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...
-
bioRxiv - Bioengineering 2020Quote: ... sgRNA targeting TP53 gene exon 5 (5’-GTTGATTCCACACCCCC.GCCcgg-3’) was cloned into lentiGuide-Puro vector (Addgene, #52963), named lentiGuide-Puro_e5.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328; http://n2t.net/addgene:19328; RRID:Addgene_19328); 100 ng/µl of a construct expressing Cas9 and a sgRNA targeting the sequence ACATGAGTCTGTGTTTACGG (derived from pDD162 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Physiology 2022Quote: ... or scramble short hairpin RNA (shRNA) (Table 3) was inserted into the plasmid pLKO.1 (8453; Addgene). pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Molecular Biology 2019Quote: ... table 3 for sgRNA sequences) together with an expression vector encoding Cas9-2A-GFP (pX458; Addgene #48138) using lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 4-363h21C1 and 3-978h1C1 and were cloned into lentiviral vector pLKO.1-puro (Addgene, catalogue #8543). Lentiviral vectors were produced in 293T cells by Fugene transfection and the supernatant was used to infect Jurkat cells ...
-
bioRxiv - Cell Biology 2019Quote: ... and 3’UTR sequence of histone H1 sequentially into the backbone vector pFGL822 (Addgene #58225, Basta resistance); pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081 ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). His3.3A reference sequence ...