Labshake search
Citations for Addgene :
301 - 350 of 1668 citations for 6 tert Butyl 4 chlorothieno 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5’-GCGCCTCCTGCGAAGCCATCAGG-3’ and 5’-CGTAGCGGGAAGGGTCAAGAGGG-3’) were similarly cloned into the lentiCRISPRv2-hygro vector (a gift from Brett Stringer, Addgene plasmid #98291)51.
-
bioRxiv - Molecular Biology 2022Quote: ... Single and double RNAi constructs targeting endogenous trap-1 and trap-3 were cloned by inserting the spliced coding sequences of trap-1 and trap-3 into vector L4440 (Addgene plasmid #1654). The constructs were then transformed into the RNAi feeding E ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Genetics 2020Quote: ... and 3’ sgRNAs were cloned into lenti_sgRNA_EFS_GFP (Addgene 65656) vector ...
-
bioRxiv - Neuroscience 2020Quote: [3] 5XQUAS from pQUAST-mCD8-GFP (Addgene plasmid #24351) (Primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with GFP-tagged galectin 3 (Addgene) or a mutant variant of it ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster U6:3 promoter fragment sequence amplified from Addgene plasmid #49411 23 with primers 1045.C1 and 1045.C2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) AAV1.hSyn.GCamP6s.WPRE.SV40 (6.67×1012 GC/kg, Addgene #100843). Before puncturing a capillary of interest ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene). Cells were incubated at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3 μg of plasmid VSVG (Plasmid #8454, Addgene) in a 10 cm dish ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537 ...
-
bioRxiv - Cancer Biology 2021Quote: ... plus pSPAX2 and pMD2.G (gifts from D. Trono; Addgene #12260 and #12259) using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pseudo typed with pMD2.G (gift of D. Trono; Addgene plasmid #12259). Following transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... sechellia UAS-SPARC2-D-CsChrimson: we digested a SPARC2-backbone vector (Addgene #133562) with SalI and inserted a CsChrimson-Venus cassette after PCR amplification from pBac(UAS-ChR2 CsChrimson,3xP3::dsRed ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Neuroscience 2023Quote: The gcy-8p::gfp::egl-4 plasmid was constructed by replacing the promoter in the odr-3p::gfp::egl-4 plasmid (Addgene) with the AFD-specific gcy-8 promoter using standard restriction enzyme-mediated cloning ...
-
bioRxiv - Biophysics 2019Quote: The plasmids mEmerald-Zyxin-6 (Addgene plasmid # 54319; http://n2t.net/addgene:54319; RRID: Addgene_54319) and mCherry-Paxillin-22 (Addgene plasmid # 55114 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-hSyn-DIO-mCherry (control, titer 6 × 1012 cfu/ml, 250nl bilateral, #50459, Addgene), AAV5-hSyn-GFP-Cre (titer 3.5 × 1012 cfu/ml ...
-
bioRxiv - Synthetic Biology 2022Quote: ... we have combined them all in a pX330A-dCas9 1×6 (Plasmid #63600, Addgene). Cloning of oligonucleotides was confirmed by DNA sequencing ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... A cDNA for GFP-tagged mouse septin 6 was obtained from Addgene (plasmid #38296) and cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2024Quote: ... grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260) packaging plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system ...
-
bioRxiv - Cancer Biology 2019Quote: ... shNRF2 #2 (TRCN0000284998, Addgene #136585), shJUND #1 (TRCN0000416347 ...
-
bioRxiv - Cancer Biology 2019Quote: ... shJUND #2 (TRCN0000416920, Addgene #136583).
-
bioRxiv - Genomics 2019Quote: ... pMDG.2 (3.2µg; Addgene #12259), TKOv3 plasmid library (8µg) ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg BFP-KDEL (Addgene plasmid #49150 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 µg psPAX2 (#12260, Addgene), and 2 µg pMD2.G (#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pLKO_HOXB13_#2 (Addgene #70094) were used for shRNA knock-down ...
-
bioRxiv - Immunology 2023Quote: ... 2 ug pEco (Addgene 12371), 72 uL 1 mg/mL polyethylenamine (Polysciences 23966) ...
-
bioRxiv - Immunology 2023Quote: ... and pcDNA3.3_SARS2_omicron BA.2 (Addgene plasmid #183700 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg psPAX2 (Addgene #12260), 2 μg pMD2.G (Addgene #12259) ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536) plasmids (Ngondo et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids pCXLE-hOCT3/4-shp53-F (Addgene #27077), pCXLE-hSK (#27078) ...
-
bioRxiv - Bioengineering 2022Quote: ... respectively (Supplementary Data 4, Addgene #183903 and #183904). For piggyBac integration near the Ae ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 µg of pCMV delta R8.2 (Addgene #12263) and 5 µg of vector (pCDH-CMV-MCS-EF1-GFP empty ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 µg of psPAX2 (Addgene, cat# 12260) using Lipofectamine 2000 Transfection Reagent according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 µg of pVSV-G (Addgene, Plasmid #8454), and 10 µg of lentiviral plasmid of interest were used ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4 μg pMD2.G (Addgene, plasmid 12259). 48 h post-transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4 μg of pCMV-VSV-G (Addgene #8454) and 7.5 μg of psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the ER localization marker mCherry-ER-3 (Addgene: 55041) for 2 days ...
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082 ...