Labshake search
Citations for Addgene :
301 - 350 of 844 citations for 6 oxopiperidine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 cells were transduced with lentivirus containing lentiCas9-Blast construct (Addgene #52962) and selected with growth medium containing 4 µg/ml blasticidin for approximately one week ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Neuroscience 2021Quote: ... 6-7E6 cells were resuspended in nucleofection solution and mixed with 3ug of pCAG-EGFP plasmid (Addgene, 89684) and 600nM of siRNA ...
-
bioRxiv - Microbiology 2019Quote: ... C57BL/6 MEFs were transfected with GFP- or HA-epitope tagged ubiquitin plasmids (Addgene #11928 and #18712, respectively) 24 hours before infection ...
-
bioRxiv - Biochemistry 2020Quote: The original coding sequence for H2B:GFP was taken from pCS2-H2B:GFP plasmid (Addgene, Plasmid #53744, Supplementary Fig. 6), manually codon-optimized to minimize the occurrence of poly-Cn stretches (n<3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two million iPSCs were electroporated with 6 μg of CAG- Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV5-CMV-EGFP (Suppl. Figs. 1A, 6 and 7D; Salk Vector Core; 2.08 x 1012; Addgene plasmid #32395); AAV9-FLEX-rev-ChR2-tdTomato (Suppl ...
-
bioRxiv - Neuroscience 2020Quote: The DNA fragment of H2B-mEos4b-6 (a gift from Michael Davidson (Addgene plasmid # 57508; http://n2t.net/addgene:57508; RRID:Addgene_57508)) and TRE (pTRE-tight vector (Clontech #631059) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Lee and Luo 1999)- with the codon optimized GAL80 sequence from pBPGAL80Uw-6 - a gift from Gerald Rubin (Addgene plasmid #26236, http://n2t.net/addgene:26236; RRID:Addgene_26236) (Pfeiffer et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were plated in 6-well plate and co-transfected with SBE4-Luc plasmid (1 μg, Addgene,16495) and pDEST26-Renilla plasmid (0.1 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... EGFP-Tubulin-6 was a gift from Michael Davidson (Addgene plasmid # 56450; http://n2t.net/addgene:56450; RRID: Addgene_56450). mTagBFP-Lysosomes-20 was a gift from Michael Davidson (Addgene plasmid # 55263 ...
-
bioRxiv - Cell Biology 2023Quote: ... Two million iPSCs were electroporated with 6 µg of CAG-Cas9-T2A-EGFP-ires-Puro (deposited in Addgene, plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Molecular Biology 2019Quote: ... GFP-POLE3 full length and GFP-POLE3 with amino acid residues 113-140 deleted (GFP-POLE3ΔC) were cloned between NheI and AgeI restriction sites of pCW57.1 (Addgene: 41393),
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Cell Biology 2020Quote: mCherry-ER fusion protein was amplified by PCR from mCherry-ER-3 plasmid (Addgene) and cloned into Gateway modified pBABE (in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777).
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pCMV4-3 HA/IkB-alpha was a gift from Warner Greene (Addgene, #21985). To generate firefly luciferase (Fluc)-expressing vector (pNL1.1.PGK[Fluc/PGK] ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328; http://n2t.net/addgene:19328; RRID:Addgene_19328), and pMA122 - peel-1 negative selection (Addgene plasmid # 34873 ...
-
bioRxiv - Genomics 2020Quote: ... We then selected then 3 sgRNAs to be cloned into lentiGuide-Puro (52963, Addgene) as previously described95 ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... and 3’ extensions were annealed and cloned into pU6-pegRNA-GG-acceptor (Addgene #132777). The oligos are listed in Table S3.
-
bioRxiv - Immunology 2022Quote: The genome-wide library Toronto KnockOut (TKO) CRISPR Library – Version 3 (TKOv3, #90294, Addgene) 39 ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Genetics 2020Quote: ... The U6:3 promoter was PCR amplified from pAC-U63-tgRNA-Rev (Addgene #112811). The CR7T promoter was synthesized as a gBlock DNA fragment (IDT ...
-
bioRxiv - Genomics 2019Quote: ... Each sequence was then transferred to the pMW#2 and pMW#3 vectors (Addgene) using the LR Clonase II (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...
-
bioRxiv - Microbiology 2022Quote: MacroH2A1 guide RNA (gRNA, see Table 3) was cloned into TLCv2 (Addgene plasmid: 87360), a plasmid encoding doxycycline-inducible Cas9-2A-GFP and gRNA expression ...
-
bioRxiv - Microbiology 2022Quote: ... PCMV4-3 HA/IκBα (SS32,36AA) was a gift from Warner Greene (Addgene plasmid #24143) and pLVX-EF1α-IRES-Puro was purchased from Clontech Laboratories (plasmid #631988).
-
bioRxiv - Microbiology 2023Quote: ... ATG16L1 shRNA (5’-GTCATCGACCTCCGGACAAAT-3’) was inserted into pLKO.1 puro (Addgene plasmid #8453) to generate pLKO.1-ATG16L1-shRNA ...
-
bioRxiv - Genetics 2023Quote: ... 3 µg of the plasmid pCMV-VSV-G (a gift from Bob Weinberg (Addgene plasmid #8454 ...