Labshake search
Citations for Addgene :
301 - 350 of 2661 citations for 5 5 7 7 Tetramethyl 1 5 6 7 tetrahydrocyclopenta f indazol 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: RAW 264.7 cells stably expressing FL-Cas9 were generated by transducing RAW 264.7 cells with lentivirus containing LentiCas9-Blast (Addgene plasmid #52962)(Sanjana et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... The full CD3-CD90.2 insert was further subcloned into the pMX vectors with different promoters using BamHI and HindIII (Addgene #163334-7).
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Microbiology 2021Quote: A 2933 bp in vitro DNA synthesized IRES-vpr mKO fragment was ordered from Genewiz (South Plainfield, NJ) using an IRES sequence from pTRIPZ-hDDX5/7 (Addgene Plasmid #71307) (64 ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... Following AAVs were used: AAVrg-CAG-FLEX-rc[Jaws-KGC-GFP-ER2] (titer >7×1012 vg/ml, viral prep #84445-AAVrg, Addgene, US,34) or AAVrg-hSyn-DIO-hM3D(Gq)-mCherry (titer >7×1012 vg/ml ...
-
bioRxiv - Cell Biology 2021Quote: HEK-293T cells plated on polylysine-coated coverslips were transfected with cDNA (100 ng/40000 cells) coding for mitochondrial-targeted mCherry (mCherry-Mito-7, a gift from Michael Davidson (Addgene plasmid # 55102), (Olenych et al ...
-
bioRxiv - Molecular Biology 2023Quote: Firefly and Renilla luciferase expression plasmids were cloned by standard methods starting with the pGL3 PUb-luc plasmid described previously (7) and pSLfa-PUb-MCS (Addgene plasmid # 52908). Transgenesis plasmids were generated using NEBuilder HiFi Assembly Master Mix (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... CRISPR-mediated gene disruption was performed by identifying individual gRNA sequences with consistent enrichment in LDLlow cells in our previously reported CRISPR screens [7] and cloning these sequences into the BsmBI sites of pLentiCRISPRv2 (Addgene #52961, [43]) or into the BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Vectors for eukaryotic expression of Gs12-7 or Gs12-10 were constructed into Age I and BamH I sites of pLenti-Puro (Addgene plasmids #39481)58 following human codon optimization ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Neuroscience 2024Quote: ... For Ca2+ imaging of mPFC layer 5 excitatory neurons 1 μl pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (Addgene) was injected bilaterally into mPFC of VGlut2-cre mice (+0.9 mm anterior-posterior ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...