Labshake search
Citations for Addgene :
301 - 350 of 3412 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...
-
MEK inhibitor resistance in lung cancer cells associated with addiction to sustained ERK suppressionbioRxiv - Cancer Biology 2022Quote: The sgRNA sequence for RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) was cloned into lentiCRISPRv2 (Addgene #52961) plasmid and the co-transfected with psPAX2 (Addgene #12260 ...
-
bioRxiv - Molecular Biology 2021Quote: ... laevis b-globin 5′- and 3′-UTR sequences were obtained from pT7TS (Addgene #17091). Mouse Malat1 3′ sequence was obtained from the Comp.25 mutant plasmid (Wilusz et al. ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Neuroscience 2021Quote: Mice anaesthetized using isoflurane were bilaterally infused with pAAV2-hSyn-DIO-hM3D(Gq)- mCherry (≥ 6 × 1012 vg/mL; Addgene #44361, Lot v58216). After exposing the skull and creating small <2mm bilateral holes with a dental drill (Stoelting ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... was expressed in E.coli using a gene with an N-terminal 6×His-tag and an upstream TEV-protease site cloned into pET28a(+) (Addgene plasmid #20061). MSP1D1 was purified using IMAC with further cleavage of 6×His-tag by TEV protease 50,51 ...
-
bioRxiv - Neuroscience 2023Quote: ... were designed to target CEP290 exon 6 and cloned into the pSpCas9(BB)-2A-GFP (PX458; gift from Feng Zhang; Addgene plasmid #48138). RPE1 cells were transfected with this plasmid by using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Immunology 2024Quote: ... 293T cells were transfected with 10 ug of lenti-CRISPR-V2-CRE construct along with packaging plasmid 6 ug of PsPAX2 (Addgene, Cat #12260) and 3.5 ug of PmD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ppyCAG_RNaseH1_WT employed for the transient overexpression of RNAseH1 in vitro on HEPA1-6 cells was a gift from Xiang-Dong Fu (Addgene plasmid #111906).
-
bioRxiv - Biochemistry 2024Quote: ... was subcloned into the pET His 6 glutathione-S-transferase (GST) TEV LIC cloning vector (2G-T, obtained from Scotta Gradia, Addgene plasmid #29707) and transformed into BL21 (DE3 ...
-
bioRxiv - Neuroscience 2024Quote: A plasmid encoding human TDP-43 with a C-terminal His×6-MBP tag was purchased from Addgene (pJ4MTDP-43, Addgene #104480). Two additional plasmids encoding IDRsTDP-2(Extended Data Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA (5’ - TTACTGCTCATCCTTGTCCT-3’) was cloned into pCFD5 vector (Port et al., 2014) (Addgene #73914) and then the resulting vector was injected into attP2 site (BDSC #25710) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rev 5’-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3’ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5′-GGCTGCCGTAGCGCGACGTG-3′) were cloned into pLentiCRISPRv2 (Addgene-52961). An NT gRNA (5′-GTATTACTGATATTGGTGGG-3′ ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SgRNA targeting EGFR (5’-CGATCTCCACATCCTGCCGG-3’) was cloned into the lentiGuide-puro vector (Addgene, USA) (18) ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... The two configurations that enabled efficient packaging of full-length vector genomes (designs 1 and 4) are available on Addgene (pEJS1099: Dual-sgRNA:Design 4, Addgene #159537; pEJS1096: Dual-sgRNA:Design 1, Addgene # 159538). Oligonucleotides with spacer sequences for target genes were inserted into the sgRNA cassette by ligation into the BspQI and BsmBI cloning sites.
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Genetics 2022Quote: ... were cloned into pCFD4-U6:1-U6:3 (Addgene® plasmid #49411 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-CCTACGAACTCCGGTGTCAG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al.,21 and introduced into ciPTEC using PolyPlus JetPrime ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Optimal gRNA (5’-GTCGTAAAGCTGGAGAACGG-3’) was cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene #48138) as described previously by Ran et al ...
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... compact BFP-tagged CRISPRi sublibraries containing 5 sgRNAs per TSS (Addgene, Cat#83971-3 and #83975) expressed in the pCRISPRi-v2 expression vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Neuroscience 2024Quote: USP14_Reverse: 5’ AAACCCAATGGTATTCAAGGCTCACC 3’ were cloned into pSpCas9(BB)-2A-Puro vector (PX459, 62988, Addgene, USA) using FastDigest BpiI (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles containing the sgRNA against mouse Rap1 (target: 5’-GCAGTCTAGGATGTACTGCG-3’) in lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2024Quote: ... reverse primer: 5’-ATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCTTAAAC-3’) and cloned into pLentiCRISPRv2-Opti (a gift from David Sabatini; Addgene plasmid # 163126 ...
-
bioRxiv - Cell Biology 2024Quote: Full-length human CEP152 with gRNA resistance (5’-CAGAACAGTTAGAAATGAGT-3’) in pAID 1.1C-T2A-Bsr (Addgene) and CEP152D43/44A in pEGFP-C1 were synthesized by GenScript ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Microbiology 2020Quote: Lentivirus-derived VLPs were produced by transfecting 10 cm dishes of HEK293T LentiX cells with lentiviral packaging plasmids encoding Gag/Pol (pMDLg/pRRE, 15 µg) and Rev (pRSV-REV, 6 µg) (Addgene plasmids 12251 and 12253) together with vectors expressing SARS-CoV-2 Spike (13 µg ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and eGFP cDNA (without 1st ATG) were linked using 4 amino acid “DLEL” and subcloned into pLenti-CMV-EGFP-Blasticidin lentiviral vector (Addgene, 17445) backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Biochemistry 2020Quote: An sgRNA sequence targeting NRF2 (5’-TATTTGACTTCAGTCAGCGA-3’) was cloned into the lentiCRISPR v2 vector (Addgene #52961). Lentiviral packaging was performed by co-transfecting the resulting plasmid with psPAX2 (Addgene 12260 ...