Labshake search
Citations for Addgene :
301 - 350 of 813 citations for 2 Trimethylsilyl ethynyl toluene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... YAP-targeting shRNA vectors 1 and 2 refer to pLKO1-shYAP1 (Addgene, #27368) and pLKO1-shYAP2 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.50 µL of AAV5.FLEX.ArchT.tdTomato (diluted 1:2 with dPBS; Addgene number: 28305) was injected in basal forebrain of ChAT-Cre animals using the coordinates described above ...
-
bioRxiv - Cell Biology 2022Quote: ... 1–2 (lenti-TRE3G-ApaLI(*)-Hygro) were cloned into LT3REVIR (Addgene Plasmid #111176) by inserting mito-ApaLI(* ...
-
bioRxiv - Neuroscience 2022Quote: (2) Chronic Window Implantation and Sparse Labeling: Viral vectors were purchased from Addgene. For viral injections and chronic window implantation ...
-
bioRxiv - Neuroscience 2022Quote: The AAV-2 ITR containing plasmids pGP-AAV-CAG-FLEX-jGCaMP7s-WPRE (Addgene plasmid #104495 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Neuroscience 2022Quote: ... ssAAV-retro/2-hEF1α-iCre-WPRE-bGHp (constructed by the VVF, Addgene #24593) was injected into the DMS (AP:+0.5mm ...
-
bioRxiv - Immunology 2022Quote: ... The replacement was mediated by homologous recombination using a PGKneolox2DTA.2 (Addgene #13449) construct and one guide RNA that targeted the mouse Vκ3-7 segment ...
-
bioRxiv - Biochemistry 2023Quote: ... PDZ2 or PDZ1+2 tandem were obtained from Addgene (Tonikian et al., 2008) or purchased from GeneScript respectively and transformed into E ...
-
bioRxiv - Synthetic Biology 2024Quote: ... we first obtained the CoV-2 genomic fragment from pSLQ5080_pHR_PGK_sfGFP_CoV-F2 (Addgene #155304) and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212 ...
-
bioRxiv - Cell Biology 2024Quote: mEos 2 Paxillin-22 was a gift from Michael Davidson (Addgene no, 57409).
-
bioRxiv - Microbiology 2024Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175, https://www.addgene.org/42175/; RRID:Addgene_42175) as template and the HA-coding sequence was included in one of the primer to generate a C-terminally HA-tagged IGF2BP2 ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 x 1011 viral genomes of PHP.eB-CAG-FLEX-GFP (Addgene #5150270) per animal ...
-
bioRxiv - Microbiology 2024Quote: ... and Illumina read 2 was generated from the plasmid pPEPZ-sgRNAclone (Addgene#141090) (de Bakker et al ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Neuroscience 2024Quote: AAV2/1-syn-GCaMP7s (Addgene 104487, 100–200 nl, 2 × 1013 GC / ml) was unilaterally injected into the MPOA of C57BL/6J mice using a Nanoject II or Nanoject III injector (Drummond Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.5 µg of the SARS-CoV-2 Np coding plasmid (Addgene, cat.141391) was co-transfected as well ...
-
bioRxiv - Cell Biology 2024Quote: ... we expressed the GST-tagged WIPI1/2d/3/4 from a pCAG backbone encoding GST-TEV-WIPI1/2/3/4 (RRID:Addgene_223798; RRID:Addgene_223799; RRID:Addgene_223800; RRID:Addgene_223801). The protein was expressed in FreeStyleTM HEK293F cells ...
-
bioRxiv - Cell Biology 2020Quote: ... the pET30-2-GAPDH plasmids was a gift from David Sabatini (Addgene plasmid # 83910) (Pacold et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... The SARS-CoV-2 S-6P plasmid was a gift from Jason McLellan (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 μg of viral entry protein VSV-G plasmid pMD2.G (Addgene; 12259) were mixed into 600 μl of serum-free DMEM ...
-
bioRxiv - Genomics 2020Quote: ... pCFJ90 - Pmyo-2∷mCherry∷unc-54utr (Addgene plasmid # 19327; http://n2t.net/addgene:19327; RRID:Addgene_19327), pCFJ104 - Pmyo-3∷mCherry∷unc-54 (Addgene plasmid # 19328 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2) EF1α promoter and puro resistance gene were amplified from lentiGuide-Puro (Addgene #52963). 3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA of SKAP2WT and SKAP2W336K (see Table 2) was transferred into pLEX_307 (Addgene #41392). For analysis of subcellular localization ...
-
bioRxiv - Microbiology 2021Quote: ... The pCRISPomyces-2 vector used in this study was obtained from Addgene (Code: 617374). All the media and chemicals were used in this study were purchased from Hi-media (Mumbai-India ...
-
bioRxiv - Microbiology 2021Quote: The Plasmid expressing SARS CoV-2 Spike protein (Wuhan isolate) was procured from Addgene with 19 nineteen amino acids deletion at C- terminal that enables efficient lentiviral packaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2×106 cells were co-transfected with Cas9 (pU6_CBh-Cas9-T2A-BFP: Addgene #64323) and gRNA (pSPgRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... psiCHECK-2-Sal4-wt_3’UTR was a gift from Robert Blelloch (Addgene plasmid # 31862). psiCHECK-2-Rab GTPases were generated by inserting Rab GTPases into psiCHECK- 2-Sal4-wt_3’UTR by XhoI/NotI.Tetanus toxin light chain (Eisel et al. ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Neuroscience 2022Quote: ... All AAV plasmids presented in this study are available from Addgene (Supplementary Table 2).
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Biochemistry 2021Quote: ... elegans ERH-2 (NCBI gene ID: 185323) was cloned into pET28a (Addgene: 69864-3), containing an N-terminal His6 tag followed by a TEV protease cleavage site (MGSSHHHHHHSSGENLYFQGHMAS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 gRNA plasmids were generated per construct and were integrated into pX330 (Addgene# 42230) using BbsI site as previously described 16 ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Neuroscience 2023Quote: ... bolus injections of either AAV serotype 9 or 2 were (Addgene, Watertown, MA, USA) delivered and followed by a flush of 200 μL of sterile saline ...
-
bioRxiv - Molecular Biology 2023Quote: ... two different gRNAs for SETD6 (Table 2) were cloned into lentiCRISPR plasmid (Addgene, #49535). Following transduction and puromycin selection (2.5 µg/ml) ...
-
bioRxiv - Microbiology 2023Quote: ... Shedu-ΔNL constructs were cloned into UC Berkeley Macrolab vector 2-BT (Addgene #29666), which encodes an N-terminal TEV protease-cleavable His6 tag.
-
bioRxiv - Neuroscience 2024Quote: ... postnatal 2-3 months) were injected bilaterally with pAAV-CaMKIIa-hM4D(Gi)-mCherry (Addgene: AAV8 ...
-
bioRxiv - Microbiology 2023Quote: SARS-CoV-2 S HexaPro was a gift from Jason McLellan (Addgene plasmid #154754) 21 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2) the NLS-Cas9 gene from the pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) connected to the promoters and 3’-UTRs from the β2tubulin (AAEL019894) ...
-
bioRxiv - Molecular Biology 2022Quote: ... HeLa cells (ATCCCCL-2) were transiently transfected with SpCas9-expressing PX459 plasmid (Addgene # 62988) using Lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors expressing ChrimsonR (pAAV1-Syn-ChrimsonR-tdT; 2 × 10^13 GC/ml; Addgene) 27 or channelrhodopsin-2 (hChR2 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first cloned 2 single guide RNAs (sgRNAs) into a pCFD5 plasmid (Addgene #73914): sgRNA1 atcgtccggcagccagcgttcgg (189bp upstream of the start codon ...
-
bioRxiv - Cell Biology 2023Quote: ... elegans cDNA library and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes a TEV protease-cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... plasmids of interest (see plasmids section) were co-transfected with psPAX.2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Immunology 2024Quote: ... gRNA#2: ATGTTGGCTAGCTGTCGATT (Exon2 ORF bp196-215) and cloned into lentiCRISPRv1 (Addgene, plasmid 49535). After lentiviral transduction using lentiCRISPRv1 as control as described below ...
-
bioRxiv - Biochemistry 2024Quote: ... according to manufacturer protocol with 2:1 donor:sleeping beauty transposase plasmids (Addgene Plasmid #34879)80 ...
-
bioRxiv - Neuroscience 2024Quote: ... For calcium imaging an AAV was injected (AAV1.Syn.GCaMP6m.WPRE.SV40; RRID: Addgene_100841, titre: 2*1012) into the PPC (from Bregma ...