Labshake search
Citations for Addgene :
3001 - 3050 of 3058 citations for 6 CHLORO 2 3 4 4A 9 9A HEXAHYDRO 1H CARBAZOLE 1 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Neuroscience 2023Quote: Calcium indicator expression in vLGN/IGL neurons was achieved with AAV-hSynapsin1- FLEx-axon-GCaMP6s (1 × 1012 genome copies per ml, Addgene, 112010-AAV5) for retinal expression AAV2.7M8-syn-GCaMP8m viral vectors (1 × 1013 genome copies per ml) ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of mKif6 FL (1-803aa) and ML (360-803aa) were subcloned into pmCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563). mCherry was removed and mKif6 (1-493aa)-mNeonGreen was added into pmCherry2 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2024Quote: ... These were then assembled into a pLenti CMV V5-LUC Blast (w567-1) digested with BstXI (a gift from Eric Campeau (Addgene plasmid # 21474). Cy3 labeled collagen was prepared as previously described (Doyle ...
-
bioRxiv - Cell Biology 2024Quote: ... The third generation HIV-1 derived lentiviral vector LeGO-iG2-Puro+-Luc2 expresses the Luc2 variant of firefly luciferase (cloned from AddGene Plasmid 24337) under the control of an SFFV-promoter ...
-
bioRxiv - Neuroscience 2024Quote: Neurons were isolated by first virally labeling neurons from the same batch with pAAV-CAG-tdTomato for 24 hours (1:50 dilution, Addgene 59462-AAV1) prior to incorporation into miBrain or monoculture ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1) and inserted into sites of hSyn promoter in AAV-U6-sgRNA-hSyn-mCherry (a gift from Alex Hewitt, Addgene plasmid # 87916) (AAV-hMAG-mcherry) ...
-
bioRxiv - Molecular Biology 2024Quote: Mission plasmids encoding a control scrambled shRNA (Scr) and individual shRNA oligos against Pkm1 and Pkm2 (Supp. Table 1) were cloned in the pLKO_TRC001 vector (Addgene cat no. 10878) as previously described (54) ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-sACE2(WT)-8his encoding soluble human ACE2 (UniProt Q9BYF1, residues 1-732) was a gift from Erik Procko (Addgene plasmid #149268) and was expressed and purified as described above for the other recombinant proteins.
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...
-
bioRxiv - Cell Biology 2022Quote: Dynamin-1-mCherry and dynamin-1(K44A)-mCherry were made by replacing the GFP from WT Dyn1 pEGFP and K44A Dyn1 pEGFP (Addgene #34680 and #34681), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... was obtained through Addgene as a ready-to-use lentiviral pooled library at a titer ≥ 1×107 TU/mL (Addgene, cat. #73178-LV). To deliver the Brunello sgRNA library ...
-
bioRxiv - Developmental Biology 2019Quote: ... We amplified PCR fragments with the respective primers (see Table S1 for information about the gRNAs and Table S2 for primer sequences used) and 1 ng pCFD6 (Addgene, Cat. No: 73915) as template utilizing Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetanus Neurotoxin Light Chain (TeLC) viruses were generated using AAV5-hSyn-FLEX-TeLC-P2A-dTomato (Addgene, 159102, 1 × 1013 genome copies per ml) at ISTA viral facility ...
-
bioRxiv - Molecular Biology 2024Quote: ... The synthetic sgRNA oligo pair complementary to exon 1 was designed and cloned into lentiCRISPRv2 vector (Addgene #52961, gift from Dr. Feng Zhang)143 following the published protocol.49 For virus production ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Biophysics 2023Quote: The full-length α-synuclein monomer (1−140) expression plasmid (pET21a-alpha-synuclein) was a gift from Michael J Fox Foundation MJFF (Addgene plasmid # 51486). The α-synuclein monomer was expressed and purified following the previous method20,21 ...
-
bioRxiv - Genetics 2024Quote: We use two constructs for epigenome editing: 1) dCAS9-DNMT3A/3L co-expressed with enhanced green fluorescent protein (eGFP) for selection 12 (Addgene, Catalogue number 128424), and 2 ...
-
bioRxiv - Neuroscience 2024Quote: ... sechellia nos-Cas9 (Auer et al., 2020) or co-injected with pHsp70-Cas9 (400 ng μl−1) (Addgene #45945; for D. simulans transgenesis) (Gratz et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were co-transfected using lentiviral packaging plasmids (psPAX2 and pMD2.G) with a PLKO.1-blast plasmid (Addgene, Cambridge, MA, USA, #26655) containing shSmad2 or shYAP ...
-
bioRxiv - Cancer Biology 2019Quote: ... H2B-RFP in pENTR1A (w507-1) and pENTR1A-GFP-N2 (FR1) were gifts from Eric Campeau and Paul Kaufman (Addgene plasmids # 22525 and # 19364). H2B-GFP plasmids were transduced using lentivirus infections.
-
bioRxiv - Cancer Biology 2022Quote: For CRISPR/Cas9 knockout AMPK sgRNA plasmids targeting exon 1 of AMPK α1 and αβ (pX462-hPRKAA1-gRNA, pX462-hPRKAA2-gRNA, #74374-74377) were purchased from Addgene (Watertown, MA, USA). LNT-229 ...
-
bioRxiv - Cancer Biology 2022Quote: 293T cells were transfected with packaging plasmids (8 μg of pCMV-dR8.2 dVPR and 1 μg pCMV-VSV-G, a gift from Robert Weinberg, Addgene plasmid #8455 and 8454, respectively) along with shRNA plasmids (8 μg ...
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...